Sequence and Quality Data: FASTQ Format

Four lines per sequence:

  1. ID
  2. Sequence
  3. ID
  4. Base call qualities (Phred scores) as ASCII characters

The following gives an example of 3 Illumina reads in a FASTQ file. The numbers at the beginning of each line are not part of the FASTQ format. They have been added solely for illustration purposes.

1. @SRR038845.3 HWI-EAS038:6:1:0:1938 length=36
2. CAACGAGTTCACACCTTGGCCGACAGGCCCGGGTAA
3. +SRR038845.3 HWI-EAS038:6:1:0:1938 length=36
4. BA@7>B=>:>>7@7@>>9=BAA?;>52;>:9=8.=A
1. @SRR038845.41 HWI-EAS038:6:1:0:1474 length=36
2. CCAATGATTTTTTTCCGTGTTTCAGAATACGGTTAA
3. +SRR038845.41 HWI-EAS038:6:1:0:1474 length=36
4. BCCBA@BB@BBBBAB@B9B@=BABA@A:@693:@B=
1. @SRR038845.53 HWI-EAS038:6:1:1:360 length=36
2. GTTCAAAAAGAACTAAATTGTGTCAATAGAAAACTC
3. +SRR038845.53 HWI-EAS038:6:1:1:360 length=36
4. BBCBBBBBB@@BAB?BBBBCBC>BBBAA8>BBBAA@

Sequence and Quality Data: QualityScaleXStringSet

Phred quality scores are integers from 0-50 that are stored as ASCII characters after adding 33. The basic R functions rawToChar and charToRaw can be used to interconvert among their representations.

Phred score interconversion

phred <- 1:9
phreda <- paste(sapply(as.raw((phred)+33), rawToChar), collapse="")
phreda
## [1] "\"#$%&'()*"
as.integer(charToRaw(phreda))-33 
## [1] 1 2 3 4 5 6 7 8 9

Construct QualityScaledDNAStringSet from scratch

dset <- DNAStringSet(sapply(1:100, function(x) paste(sample(c("A","T","G","C"), 20, replace=T), collapse=""))) # Creates random sample sequence.
myqlist <- lapply(1:100, function(x) sample(1:40, 20, replace=T)) # Creates random Phred score list.
myqual <- sapply(myqlist, function(x) toString(PhredQuality(x))) # Converts integer scores into ASCII characters.
myqual <- PhredQuality(myqual) # Converts to a PhredQuality object.
dsetq1 <- QualityScaledDNAStringSet(dset, myqual) # Combines DNAStringSet and quality data in QualityScaledDNAStringSet object.
dsetq1[1:2]
##   A QualityScaledDNAStringSet instance containing:
## 
##   A DNAStringSet instance of length 2
##     width seq
## [1]    20 TAAAAACTTATTAGGGATGG
## [2]    20 TAAATACACACTCTCAACCA
## 
##   A PhredQuality instance of length 2
##     width seq
## [1]    20 CBAADAF?)2#?)AED6#5.
## [2]    20 HD7CE.$.8*%=B#<(3%G)

Processing FASTQ Files with ShortRead

The following expains the basic usage of ShortReadQ objects. To make the sample code work, download and unzip this file to your current working directory. The following code performs the download for you.

library(ShortRead)
download.file("http://faculty.ucr.edu/~tgirke/HTML_Presentations/Manuals/Workshop_Dec_6_10_2012/Rsequences/data.zip", "data.zip")
unzip("data.zip")

Important utilities for accessing FASTQ files

fastq <- list.files("data", "*.fastq$"); fastq <- paste("data/", fastq, sep="")
names(fastq) <- paste("flowcell6_lane", 1:length(fastq), sep="_") 
(fq <- readFastq(fastq[1])) # Imports first FASTQ file
## class: ShortReadQ
## length: 1000 reads; width: 36 cycles
countLines(dirPath="./data", pattern=".fastq$")/4 # Counts numbers of reads in FASTQ files
## SRR038845.fastq SRR038846.fastq SRR038848.fastq SRR038850.fastq 
##            1000            1000            1000            1000
id(fq)[1] # Returns ID field
##   A BStringSet instance of length 1
##     width seq
## [1]    43 SRR038845.3 HWI-EAS038:6:1:0:1938 length=36
sread(fq)[1] # Returns sequence
##   A DNAStringSet instance of length 1
##     width seq
## [1]    36 CAACGAGTTCACACCTTGGCCGACAGGCCCGGGTAA
quality(fq)[1] # Returns Phred scores 
## class: FastqQuality
## quality:
##   A BStringSet instance of length 1
##     width seq
## [1]    36 BA@7>B=>:>>7@7@>>9=BAA?;>52;>:9=8.=A
as(quality(fq), "matrix")[1:4,1:12] # Coerces Phred scores to numeric matrix
##      [,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] [,9] [,10] [,11] [,12]
## [1,]   33   32   31   22   29   33   28   29   25    29    29    22
## [2,]   33   34   34   33   32   31   33   33   31    33    33    33
## [3,]   33   33   34   33   33   33   33   33   33    31    31    33
## [4,]   33   33   33   33   31   33   28   31   28    32    33    33
ShortReadQ(sread=sread(fq), quality=quality(fq), id=id(fq)) # Constructs a ShortReadQ from components
## class: ShortReadQ
## length: 1000 reads; width: 36 cycles

FASTQ Quality Reports

Using systemPipeR

The following seeFastq and seeFastqPlot functions generate and plot a series of useful quality statistics for a set of FASTQ files.

library(systemPipeR)
fqlist <- seeFastq(fastq=fastq, batchsize=800, klength=8) # For real data set batchsize to at least 10^5 
seeFastqPlot(fqlist)

Handles many samples in one PDF file. For more details see here

Using ShortRead

The ShortRead package contains several FASTQ quality reporting functions.

sp <- SolexaPath(system.file('extdata', package='ShortRead'))
fl <- file.path(analysisPath(sp), "s_1_sequence.txt") 
fls <- c(fl, fl) 
coll <- QACollate(QAFastqSource(fls), QAReadQuality(), QAAdapterContamination(), 
	    QANucleotideUse(), QAQualityUse(), QASequenceUse(), QAFrequentSequence(n=10), 
		QANucleotideByCycle(), QAQualityByCycle())
x <- qa2(coll, verbose=TRUE)
res <- report(x)
if(interactive())
browseURL(res) 

Filtering and Trimming FASTQ Files with ShortRead

Adaptor trimming

fqtrim <- trimLRPatterns(Rpattern="GCCCGGGTAA", subject=fq)
sread(fq)[1:2] # Before trimming
##   A DNAStringSet instance of length 2
##     width seq
## [1]    36 CAACGAGTTCACACCTTGGCCGACAGGCCCGGGTAA
## [2]    36 CCAATGATTTTTTTCCGTGTTTCAGAATACGGTTAA
sread(fqtrim)[1:2] # After trimming
##   A DNAStringSet instance of length 2
##     width seq
## [1]    26 CAACGAGTTCACACCTTGGCCGACAG
## [2]    36 CCAATGATTTTTTTCCGTGTTTCAGAATACGGTTAA

Read counting and duplicate removal

tables(fq)$distribution # Counts read occurences
##   nOccurrences nReads
## 1            1    948
## 2            2     26
sum(srduplicated(fq)) # Identifies duplicated reads
## [1] 26
fq[!srduplicated(fq)]
## class: ShortReadQ
## length: 974 reads; width: 36 cycles

Trimming low quality tails

cutoff <- 30
cutoff <- rawToChar(as.raw(cutoff+33))
sread(trimTails(fq, k=2, a=cutoff, successive=FALSE))[1:2]
##   A DNAStringSet instance of length 2
##     width seq
## [1]     4 CAAC
## [2]    20 CCAATGATTTTTTTCCGTGT

Removal of reads with Phred scores below a threshold value

cutoff <- 30
qcount <- rowSums(as(quality(fq), "matrix") <= 20) 
fq[qcount == 0] # Number of reads where all Phred scores >= 20
## class: ShortReadQ
## length: 349 reads; width: 36 cycles

Removal of reads with x Ns and/or low complexity segments

filter1 <- nFilter(threshold=1) # Keeps only reads without Ns
filter2 <- polynFilter(threshold=20, nuc=c("A","T","G","C")) # Removes reads with >=20 of one nucleotide
filter <- compose(filter1, filter2)
fq[filter(fq)]
## class: ShortReadQ
## length: 989 reads; width: 36 cycles

Memory Efficient FASTQ Processing

Streaming through FASTQ files with FastqStreamer and random sampling reads with FastqSampler

fq <- yield(FastqStreamer(fastq[1], 50)) # Imports first 50 reads 
fq <- yield(FastqSampler(fastq[1], 50)) # Random samples 50 reads 

Streaming through a FASTQ file while applying filtering/trimming functions and writing the results to a new file here SRR038845.fastq_sub in data directory.

f <- FastqStreamer(fastq[1], 50) 
while(length(fq <- yield(f))) {
	fqsub <- fq[grepl("^TT", sread(fq))] 
	writeFastq(fqsub, paste(fastq[1], "sub", sep="_"), mode="a", compress=FALSE)
}
close(f)



Previous page.Previous Page                     Next Page Next page.