NGS Analysis Basics
GEN242: Data Analysis in Genome Biology
Thomas Girke
2026-05-21
Overview
Topics covered in this tutorial:
- String handling in R base
- Key Bioconductor packages for sequence analysis
- Biostrings: sequence containers, import/export, manipulation
- Pattern matching with and without mismatches
- Sequence logos and PWM searching
- NGS data: FASTQ format and quality scores
- FASTQ quality reports and QC
- Filtering and trimming FASTQ files
- Memory-efficient FASTQ processing
- Range operations with
IRangesandGRanges - Transcript ranges and
TxDbdatabases - Efficient sequence parsing from genome files
Note
HW05 tasks are linked at the end of this tutorial.
Full assignment: HW05
Key Bioconductor Packages for Sequence Analysis
R Base
Basic string handling (grep, gsub, substring) plus the full range of numeric data analysis tools.
Bioconductor — sequence-specific infrastructure
| Package | Purpose |
|---|---|
| Biostrings | General sequence analysis — the core package |
| ShortRead | Pipeline for short read / FASTQ data |
| IRanges | Low-level range data infrastructure |
| GenomicRanges | High-level genomic range data |
| GenomicFeatures | Transcript-centric annotation management |
| GenomicAlignments | Short genomic alignments |
| Rsamtools | Interface to samtools, bcftools, tabix |
| BSgenome | Genome annotation data |
| biomaRt | Interface to BioMart annotations |
| rtracklayer | Annotation imports, interface to genome browsers |
Install required packages
String Handling in R Base
Sample sequence data
String matching
[1] "ATGCAGACATAGTG" "ATGAACATAGATCC"[1] 1 1 7[1] 2 2 2pos2 <- gregexpr("AT", myseq) # positions of ALL matches per sequence
as.numeric(pos2[[1]]) # match positions in first sequence[1] 1 9[1] 2 2String substitution
[1] "atgCAGACATAGTG" "atgAACATAGATCC" "GTACAGATCAC" Positional parsing
[1] 14 14 11[1] "AT" "GCA"[1] "AT" "AAC" "ATCA"Generate random DNA sequences
Biostrings — Data Objects
The Biostrings package provides dedicated containers for biological sequences.
XString — single sequence
| Class | Use |
|---|---|
DNAString |
DNA sequence |
RNAString |
RNA sequence |
AAString |
Amino acid sequence |
BString |
Any character string |
10-letter DNAString object
seq: GCATAT-TAC4-letter DNAString object
seq: GCATXStringSet — many sequences in one object
| Class | Use |
|---|---|
DNAStringSet |
set of DNA sequences |
RNAStringSet |
set of RNA sequences |
AAStringSet |
set of amino acid sequences |
dset <- DNAStringSet(c("GCATATTAC", "AATCGATCC", "GCATATTAC"))
names(dset) <- c("seq1", "seq2", "seq3")
dset[1:2]DNAStringSet object of length 2:
width seq names
[1] 9 GCATATTAC seq1
[2] 9 AATCGATCC seq2[1] 9 9 9d <- dset[[1]] # [[ returns single entry as XString
dset2 <- c(dset, dset) # concatenate two XStringSet objects
dsetchar <- as.character(dset) # convert to named character vector
dsetone <- unlist(dset) # collapse all sequences into one DNAString
DNAStringSet(dset, start=c(1,2,3), end=c(4,8,5)) # subset by positionsDNAStringSet object of length 3:
width seq names
[1] 4 GCAT seq1
[2] 7 ATCGATC seq2
[3] 3 ATA seq3QualityScaleXStringSet — sequences with quality scores
Biostrings — Import, Export and Manipulation
Import FASTA file
# Download sample sequences
dir.create("data", showWarnings = FALSE)
download.file(
"https://ftp.ncbi.nlm.nih.gov/genomes/archive/old_genbank/Bacteria/Halobacterium_sp_uid217/AE004437.ffn",
"data/AE004437.ffn"
)
myseq <- readDNAStringSet("data/AE004437.ffn") # import FASTA
myseq[1:3]DNAStringSet object of length 3:
width seq names
[1] 1206 ATGACTCGGCGGTCTCGTGTCGGTGCCGGCCTCGCAGCCATTGTACTGGCCCTGGCCGCAGTGTCGGCTGCCGCTCCGATTGCCGGGGCGCAG...AGCGGTGGCGGGTTACCGCTGTTCAAGATCGGGGGCGCTGTCGCTGTGATTGCGATCGTCGTCGTCGTTGTTCGACGCTGGCGGAACCCATGA gi|12057215|gb|AE...
[2] 666 ATGAGCATCATCGAACTCGAAGGCGTGGTCAAACGGTACGAAACCGGTGCCGAGACAGTCGAGGCGCTGAAAGGCGTTGACTTCTCGGCGGCG...AACATCGCCGTGGTTGCGATCACTCACGACACGCAACTCGAGGAGTTCTCCGACCGCGCAGTCAACCTCGTCGATGGGGTGTTACACACGTGA gi|12057215|gb|AE...
[3] 1110 ATGGCGTGGCGGAACCTCGGGCGGAACCGCGTGCGGACTGCGCTGGCCGCGCTCGGGATCGTGATCGGTGTGATCTCGATCGCATCGATGGGG...TTCCTGTTCGCGGTCTTCGCCAGCCTGCTCAGCGGGCTCTATCCGGCGTGGAAAGCAGCCAACGATCCGCCCGTCGAGGCGCTCGGCGAATGA gi|12057215|gb|AE...Subset and export
[1] 170Basic sequence manipulations
randset <- DNAStringSet(rand) # convert random seqs to DNAStringSet
complement(randset[1:2]) # complementDNAStringSet object of length 2:
width seq
[1] 19 GAGGCCTACGGAGACGAGT
[2] 11 CCGCACAAACGDNAStringSet object of length 2:
width seq
[1] 19 ACTCGTCTCCGTAGGCCTC
[2] 11 CGTTTGTGCGGDNAStringSet object of length 2:
width seq
[1] 19 TGAGCAGAGGCATCCGGAG
[2] 11 GCAAACACGCCAAStringSet object of length 2:
width seq
[1] 6 LRMPLL
[2] 3 GVFMultiple sequence alignment
Pattern Matching with Biostrings
Biostrings supports pattern matching with mismatches — not possible with base R regex.
Match a single pattern against one sequence
myseq1 <- readDNAStringSet("./data/AE004437.ffn")
# Find all occurrences allowing 1 mismatch
mypos <- matchPattern("ATGGTG", myseq1[[1]], max.mismatch=1)
# Count matches only
countPattern("ATGGCT", myseq1[[1]], max.mismatch=1)[1] 3Match against all sequences in a set
[1] 3 0 5 4 1 2 2 1 4 3 0 0 1 2 0 1 4 0 0 1myvpos <- vmatchPattern("ATGGCT", myseq1, max.mismatch=1) # match positions (MIndex)
Views(myseq1[[1]], start(myvpos[[1]]), end(myvpos[[1]])) # retrieve matches for seq 1Views on a 1206-letter DNAString subject
subject: ATGACTCGGCGGTCTCGTGTCGGTGCCGGCCTCGCAGCCATTGTACTGGCCCTGGCCGCAGTGTCGGCTGCCGCTCCGATTGCCGGGGCGCAGTCCGCCGGCAG...CCAACGGCGCGAGCGGTGGCGGGTTACCGCTGTTCAAGATCGGGGGCGCTGTCGCTGTGATTGCGATCGTCGTCGTCGTTGTTCGACGCTGGCGGAACCCATGA
views:
start end width
[1] 1 6 6 [ATGACT]
[2] 383 388 6 [ATGGCA]
[3] 928 933 6 [ATGACT]# Retrieve match sequences across all entries
sapply(names(myseq1), function(x)
as.character(Views(myseq1[[x]], start(myvpos[[x]]), end(myvpos[[x]]))))[1:4]$`gi|12057215|gb|AE004437.1|:248-1453 Halobacterium sp. NRC-1, complete genome`
[1] "ATGACT" "ATGGCA" "ATGACT"
$`gi|12057215|gb|AE004437.1|:1450-2115 Halobacterium sp. NRC-1, complete genome`
character(0)
$`gi|12057215|gb|AE004437.1|:2145-3254 Halobacterium sp. NRC-1, complete genome`
[1] "ATGGCG" "ATGGCG" "ATGACT" "ATGGCC" "ATCGCT"
$`gi|12057215|gb|AE004437.1|:3322-5643 Halobacterium sp. NRC-1, complete genome`
[1] "ACGGCT" "GTGGCT" "ATCGCT" "ATGGCT"Consensus matrix for query and hits
tmp <- c(DNAStringSet("ATGGTG"), DNAStringSet(mypos))
consensusMatrix(tmp)[1:4,] # shows nucleotide frequency at each position [,1] [,2] [,3] [,4] [,5] [,6]
A 3 0 0 0 0 0
C 1 1 0 0 0 0
G 0 0 4 4 1 4
T 0 3 0 0 3 0Pattern matching with regular expression support
myseq <- DNAStringSet(c("ATGCAGACATAGTG", "ATGAACATAGATCC", "GTACAGATCAC"))
myseq[grep("^ATG", myseq, perl=TRUE)] # sequences starting with ATGDNAStringSet object of length 2:
width seq
[1] 14 ATGCAGACATAGTG
[2] 14 ATGAACATAGATCCDNAStringSet object of length 3:
width seq
[1] 14 NNNCAGACATAGTG
[2] 14 NNNAACATAGATCC
[3] 11 GTACAGATCACSequence Logos and PWM Searching
Build a position weight matrix (PWM)
[,1] [,2] [,3]
A 0.0000000 0.0000000 0.2312611
C 0.0000000 0.3157205 0.0000000
G 0.3685591 0.2312611 0.0000000
T 0.0000000 0.0000000 0.3157205Plot sequence logo with seqLogo
Plot with ggseqlogo (more customization options)
ggseqlogo supports various alphabets including amino acid sequences. See the manual for details.
Search a sequence for PWM matches
FASTQ Format — Sequence and Quality Data
FASTQ is the standard format for raw NGS reads. Each read occupies 4 lines:
@SRR038845.3 HWI-EAS038:6:1:0:1938 length=36
CAACGAGTTCACACCTTGGCCGACAGGCCCGGGTAA
+SRR038845.3 HWI-EAS038:6:1:0:1938 length=36
BA@7>B=>:>>7@7@>>9=BAA?;>52;>:9=8.=A| Line | Content |
|---|---|
| 1 | @ + read ID and description |
| 2 | DNA sequence |
| 3 | + (optionally repeated ID) |
| 4 | Quality scores as ASCII characters (Phred encoding) |
Phred quality scores
Phred scores are integers 0–50 stored as ASCII characters (score + 33):
phred <- 1:9
phreda <- paste(sapply(as.raw((phred)+33), rawToChar), collapse="")
phreda # ASCII representation[1] "\"#$%&'()*"[1] 1 2 3 4 5 6 7 8 9- Phred 10 = 90% base call accuracy (1 error in 10)
- Phred 20 = 99% accuracy (1 error in 100) — common QC cutoff
- Phred 30 = 99.9% accuracy (1 error in 1,000)
Working with FASTQ Files — ShortRead
Download sample data and import
library(ShortRead)
download.file(
"https://cluster.hpcc.ucr.edu/~tgirke/HTML_Presentations/Manuals/testdata/samplefastq/data.zip",
"data.zip"
)
unzip("data.zip")
fastq <- list.files("data", "*.fastq$")
fastq <- paste("data/", fastq, sep="")
names(fastq) <- paste("flowcell6_lane", 1:length(fastq), sep="_")Read and inspect a FASTQ file
fq <- readFastq(fastq[1]) # import first FASTQ file as ShortReadQ object
countLines(dirPath="./data", pattern=".fastq$") / 4 # count reads in each fileSRR038845.fastq SRR038846.fastq SRR038848.fastq SRR038850.fastq
1000 1000 1000 1000 BStringSet object of length 1:
width seq
[1] 43 SRR038845.3 HWI-EAS038:6:1:0:1938 length=36DNAStringSet object of length 1:
width seq
[1] 36 CAACGAGTTCACACCTTGGCCGACAGGCCCGGGTAAclass: FastqQuality
quality:
BStringSet object of length 1:
width seq
[1] 36 BA@7>B=>:>>7@7@>>9=BAA?;>52;>:9=8.=A [,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] [,9] [,10] [,11] [,12]
[1,] 33 32 31 22 29 33 28 29 25 29 29 22
[2,] 33 34 34 33 32 31 33 33 31 33 33 33
[3,] 33 33 34 33 33 33 33 33 33 31 31 33
[4,] 33 33 33 33 31 33 28 31 28 32 33 33class: ShortReadQ
length: 1000 reads; width: 36 cyclesConstruct a QualityScaledDNAStringSet from scratch
dset <- DNAStringSet(sapply(1:100, function(x)
paste(sample(c("A","T","G","C"), 20, replace=TRUE), collapse="")))
myqlist <- lapply(1:100, function(x) sample(1:40, 20, replace=TRUE))
myqual <- sapply(myqlist, function(x) toString(PhredQuality(x)))
myqual <- PhredQuality(myqual)
dsetq1 <- QualityScaledDNAStringSet(dset, myqual)
dsetq1[1:2] A QualityScaledDNAStringSet instance containing:
DNAStringSet object of length 2:
width seq
[1] 20 CCGGGGTCGACTCGTGGGTG
[2] 20 TGATAGACCATCCTTAACCT
PhredQuality object of length 2:
width seq
[1] 20 8-(=*FH36?5A;6,&6C8F
[2] 20 A%.C+.<G)&'GD51F?*DAFASTQ Quality Reports
Using systemPipeR to create comprehensive QC plots
Generates a multi-panel QC report covering: - Read length distribution - Per-position base quality - Per-position nucleotide frequency - K-mer frequency - Adapter contamination
Output can be written to a single PDF covering all samples.
Using ShortRead — alternative QC
sp <- SolexaPath(system.file('extdata', package='ShortRead'))
fl <- file.path(analysisPath(sp), "s_1_sequence.txt")
fls <- c(fl, fl)
coll <- QACollate(
QAFastqSource(fls),
QAReadQuality(),
QAAdapterContamination(),
QANucleotideUse(),
QAQualityUse(),
QASequenceUse(),
QAFrequentSequence(n=10),
QANucleotideByCycle(),
QAQualityByCycle()
)
x <- qa2(coll, verbose=TRUE)
res <- report(x)
if (interactive()) browseURL(res) # open HTML report in browserFiltering and Trimming FASTQ Files
All filtering operates on ShortReadQ objects and returns a filtered subset.
Adapter trimming
DNAStringSet object of length 2:
width seq
[1] 36 CAACGAGTTCACACCTTGGCCGACAGGCCCGGGTAA
[2] 36 CCAATGATTTTTTTCCGTGTTTCAGAATACGGTTAADNAStringSet object of length 2:
width seq
[1] 26 CAACGAGTTCACACCTTGGCCGACAG
[2] 36 CCAATGATTTTTTTCCGTGTTTCAGAATACGGTTAACount reads and remove duplicates
nOccurrences nReads
1 1 948
2 2 26[1] 26class: ShortReadQ
length: 974 reads; width: 36 cyclesTrim low-quality tails
cutoff <- 30
cutoff <- rawToChar(as.raw(cutoff + 33)) # convert Phred score to ASCII
sread(trimTails(fq, k=2, a=cutoff, successive=FALSE))[1:2]DNAStringSet object of length 2:
width seq
[1] 4 CAAC
[2] 20 CCAATGATTTTTTTCCGTGTRemove reads with low average quality
cutoff <- 30
qcount <- rowSums(as(quality(fq), "matrix") <= 20)
fq[qcount == 0] # keep only reads where ALL Phred scores are >= 20class: ShortReadQ
length: 349 reads; width: 36 cyclesRemove reads with Ns or low complexity
Memory-Efficient FASTQ Processing
For large FASTQ files, streaming avoids loading everything into memory at once.
Stream or randomly sample reads
Stream through a file with filtering and write output
f <- FastqStreamer(fastq[1], 50) # open streamer with chunk size 50
while (length(fq <- yield(f))) {
fqsub <- fq[grepl("^TT", sread(fq))] # keep reads starting with "TT"
writeFastq(fqsub,
paste(fastq[1], "sub", sep="_"),
mode="a", # append mode — builds file across chunks
compress=FALSE)
}
close(f) # always close the streamerTip
Streaming workflow is the standard approach for production FASTQ processing: open a FastqStreamer, yield chunks, apply filters/trimming, write output, repeat until the file is exhausted. This handles files of any size with constant memory usage.
Range Operations — IRanges and GRanges
Genomic ranges (chromosome, start, end, strand) are the foundation of most genome-scale analyses in Bioconductor.
Three key range containers
| Class | Package | Stores |
|---|---|---|
IRanges |
IRanges | integer ranges only |
GRanges |
GenomicRanges | ranges + chromosome + strand + metadata |
GRangesList |
GenomicRanges | list of GRanges objects |
Construct a GRanges object
Import a GFF/GTF file directly into a GRanges object
gff <- import.gff("https://cluster.hpcc.ucr.edu/~tgirke/Documents/R_BioCond/Samples/gff3.gff")
seqlengths(gff) <- end(ranges(gff[which(values(gff)[,"type"]=="chromosome"),]))
names(gff) <- 1:length(gff)
gff[1:4,]GRanges object with 4 ranges and 10 metadata columns:
seqnames ranges strand | source type score phase ID Name Note Parent Index Derives_from
<Rle> <IRanges> <Rle> | <factor> <factor> <numeric> <integer> <character> <character> <CharacterList> <CharacterList> <character> <character>
1 Chr1 1-30427671 + | TAIR10 chromosome NA <NA> Chr1 Chr1 <NA> <NA>
2 Chr1 3631-5899 + | TAIR10 gene NA <NA> AT1G01010 AT1G01010 protein_coding_gene <NA> <NA>
3 Chr1 3631-5899 + | TAIR10 mRNA NA <NA> AT1G01010.1 AT1G01010.1 AT1G01010 1 <NA>
4 Chr1 3760-5630 + | TAIR10 protein NA <NA> AT1G01010.1-Protein AT1G01010.1 <NA> AT1G01010.1
-------
seqinfo: 7 sequences from an unspecified genomeSeqinfo object with 7 sequences from an unspecified genome:
seqnames seqlengths isCircular genome
Chr1 30427671 NA <NA>
Chr2 19698289 NA <NA>
Chr3 23459830 NA <NA>
Chr4 18585056 NA <NA>
Chr5 26975502 NA <NA>
ChrC 154478 NA <NA>
ChrM 366924 NA <NA> seqnames start end width strand source type
1 Chr1 1 30427671 30427671 + TAIR10 chromosome
2 Chr1 3631 5899 2269 + TAIR10 gene
3 Chr1 3631 5899 2269 + TAIR10 mRNA
4 Chr1 3760 5630 1871 + TAIR10 proteinGRanges — Accessor Functions and Subsetting
Accessor functions
factor-Rle of length 449 with 7 runs
Lengths: 72 22 38 118 172 13 14
Values : Chr1 Chr2 Chr3 Chr4 Chr5 ChrC ChrM
Levels(7): Chr1 Chr2 Chr3 Chr4 Chr5 ChrC ChrMIRanges object with 449 ranges and 0 metadata columns:
start end width
<integer> <integer> <integer>
1 1 30427671 30427671
2 3631 5899 2269
3 3631 5899 2269
4 3760 5630 1871
5 3631 3913 283
... ... ... ...
445 11918 12241 324
446 11918 12241 324
447 11918 12241 324
448 11918 12241 324
449 11918 12241 324factor-Rle of length 449 with 13 runs
Lengths: 18 54 28 21 12 117 1 171 1 12 1 8 5
Values : + - + - + - + - + - + - +
Levels(3): + - * Chr1 Chr2 Chr3 Chr4 Chr5 ChrC ChrM
30427671 19698289 23459830 18585056 26975502 154478 366924 [1] 1 3631 3631 3760[1] 30427671 5899 5899 5630[1] 30427671 2269 2269 1871Accessing metadata columns
DataFrame with 449 rows and 10 columns
source type score phase ID Name Note Parent Index Derives_from
<factor> <factor> <numeric> <integer> <character> <character> <CharacterList> <CharacterList> <character> <character>
1 TAIR10 chromosome NA NA Chr1 Chr1 NA NA
2 TAIR10 gene NA NA AT1G01010 AT1G01010 protein_coding_gene NA NA
3 TAIR10 mRNA NA NA AT1G01010.1 AT1G01010.1 AT1G01010 1 NA
4 TAIR10 protein NA NA AT1G01010.1-Protein AT1G01010.1 NA AT1G01010.1
5 TAIR10 exon NA NA NA NA AT1G01010.1 NA NA
... ... ... ... ... ... ... ... ... ... ...
445 TAIR10 gene NA NA ATMG00030 ATMG00030 protein_coding_gene NA NA
446 TAIR10 mRNA NA NA ATMG00030.1 ATMG00030.1 ATMG00030 1 NA
447 TAIR10 protein NA NA ATMG00030.1-Protein ATMG00030.1 NA ATMG00030.1
448 TAIR10 exon NA NA NA NA ATMG00030.1 NA NA
449 TAIR10 CDS NA 0 NA NA ATMG00030.1,ATMG00030.1-Protein NA NA [1] chromosome gene mRNA protein exon five_prime_UTR CDS exon CDS exon CDS exon CDS
[14] exon CDS exon CDS three_prime_UTR gene mRNA
Levels: chromosome gene mRNA protein exon five_prime_UTR CDS three_prime_UTR rRNA tRNAGRanges object with 22 ranges and 10 metadata columns:
seqnames ranges strand | source type score phase ID Name Note Parent Index Derives_from
<Rle> <IRanges> <Rle> | <factor> <factor> <numeric> <integer> <character> <character> <CharacterList> <CharacterList> <character> <character>
2 Chr1 3631-5899 + | TAIR10 gene NA <NA> AT1G01010 AT1G01010 protein_coding_gene <NA> <NA>
19 Chr1 5928-8737 - | TAIR10 gene NA <NA> AT1G01020 AT1G01020 protein_coding_gene <NA> <NA>
64 Chr1 11649-13714 - | TAIR10 gene NA <NA> AT1G01030 AT1G01030 protein_coding_gene <NA> <NA>
74 Chr2 1025-2810 + | TAIR10 gene NA <NA> AT2G01008 AT2G01008 protein_coding_gene <NA> <NA>
84 Chr2 3706-5513 + | TAIR10 gene NA <NA> AT2G01010 AT2G01010 rRNA <NA> <NA>
... ... ... ... . ... ... ... ... ... ... ... ... ... ...
427 ChrC 383-1444 - | TAIR10 gene NA <NA> ATCG00020 ATCG00020 protein_coding_gene <NA> <NA>
432 ChrC 1717-4347 - | TAIR10 gene NA <NA> ATCG00030 ATCG00030 tRNA <NA> <NA>
437 ChrM 273-734 - | TAIR10 gene NA <NA> ATMG00010 ATMG00010 protein_coding_gene <NA> <NA>
442 ChrM 8848-11415 - | TAIR10 gene NA <NA> ATMG00020 ATMG00020 rRNA <NA> <NA>
445 ChrM 11918-12241 + | TAIR10 gene NA <NA> ATMG00030 ATMG00030 protein_coding_gene <NA> <NA>
-------
seqinfo: 7 sequences from an unspecified genomeSubsetting and concatenation
GRanges object with 4 ranges and 10 metadata columns:
seqnames ranges strand | source type score phase ID Name Note Parent Index Derives_from
<Rle> <IRanges> <Rle> | <factor> <factor> <numeric> <integer> <character> <character> <CharacterList> <CharacterList> <character> <character>
1 Chr1 1-30427671 + | TAIR10 chromosome NA <NA> Chr1 Chr1 <NA> <NA>
2 Chr1 3631-5899 + | TAIR10 gene NA <NA> AT1G01010 AT1G01010 protein_coding_gene <NA> <NA>
3 Chr1 3631-5899 + | TAIR10 mRNA NA <NA> AT1G01010.1 AT1G01010.1 AT1G01010 1 <NA>
4 Chr1 3760-5630 + | TAIR10 protein NA <NA> AT1G01010.1-Protein AT1G01010.1 <NA> AT1G01010.1
-------
seqinfo: 7 sequences from an unspecified genomeGRanges object with 4 ranges and 2 metadata columns:
seqnames ranges strand | type ID
<Rle> <IRanges> <Rle> | <factor> <character>
1 Chr1 1-30427671 + | chromosome Chr1
2 Chr1 3631-5899 + | gene AT1G01010
3 Chr1 3631-5899 + | mRNA AT1G01010.1
4 Chr1 3760-5630 + | protein AT1G01010.1-Protein
-------
seqinfo: 7 sequences from an unspecified genomeGRanges object with 4 ranges and 10 metadata columns:
seqnames ranges strand | source type score phase ID Name Note Parent Index Derives_from
<Rle> <IRanges> <Rle> | <factor> <factor> <numeric> <integer> <character> <character> <CharacterList> <CharacterList> <character> <character>
1 Chr1 1-30427671 + | TAIR10 chromosome NA <NA> Chr1 Chr1 <NA> <NA>
2 Chr1 3631-5899 + | TAIR10 mRNA NA <NA> AT1G01010.1 AT1G01010.1 AT1G01010 1 <NA>
401 Chr5 5516-5769 - | TAIR10 protein NA <NA> AT5G01015.2-Protein AT5G01015.2 <NA> AT5G01015.2
402 Chr5 5770-5801 - | TAIR10 five_prime_UTR NA <NA> <NA> <NA> AT5G01015.2 <NA> <NA>
-------
seqinfo: 7 sequences from an unspecified genomeGRanges — Range Utilities
Modify ranges
Set operations on ranges
GRanges object with 22 ranges and 0 metadata columns:
seqnames ranges strand
<Rle> <IRanges> <Rle>
[1] Chr1 3631-5899 *
[2] Chr1 5928-8737 *
[3] Chr1 11649-13714 *
[4] Chr2 1025-2810 *
[5] Chr2 3706-5513 *
... ... ... ...
[18] ChrC 383-1444 *
[19] ChrC 1717-4347 *
[20] ChrM 273-734 *
[21] ChrM 8848-11415 *
[22] ChrM 11918-12241 *
-------
seqinfo: 7 sequences from an unspecified genomeGRanges object with 43 ranges and 0 metadata columns:
seqnames ranges strand
<Rle> <IRanges> <Rle>
[1] Chr1 1-30427671 +
[2] Chr1 1-30427671 -
[3] Chr1 1-3630 *
[4] Chr1 5900-5927 *
[5] Chr1 8738-11648 *
... ... ... ...
[39] ChrM 1-366924 -
[40] ChrM 1-272 *
[41] ChrM 735-8847 *
[42] ChrM 11416-11917 *
[43] ChrM 12242-366924 *
-------
seqinfo: 7 sequences from an unspecified genomeGRanges object with 29 ranges and 0 metadata columns:
seqnames ranges strand
<Rle> <IRanges> <Rle>
[1] Chr1 1-3630 *
[2] Chr1 5900-5927 *
[3] Chr1 8738-11648 *
[4] Chr1 13715-30427671 *
[5] Chr2 1-1024 *
... ... ... ...
[25] ChrC 4348-154478 *
[26] ChrM 1-272 *
[27] ChrM 735-8847 *
[28] ChrM 11416-11917 *
[29] ChrM 12242-366924 *
-------
seqinfo: 7 sequences from an unspecified genomeGRanges object with 211 ranges and 0 metadata columns:
seqnames ranges strand
<Rle> <IRanges> <Rle>
[1] Chr1 3631-3759 *
[2] Chr1 3760-3913 *
[3] Chr1 3914-3995 *
[4] Chr1 3996-4276 *
[5] Chr1 4277-4485 *
... ... ... ...
[207] ChrC 1752-4310 *
[208] ChrC 4311-4347 *
[209] ChrM 273-734 *
[210] ChrM 8848-11415 *
[211] ChrM 11918-12241 *
-------
seqinfo: 7 sequences from an unspecified genomeRleList of length 7
$Chr1
integer-Rle of length 30427671 with 45 runs
Lengths: 3630 129 154 82 281 209 120 100 390 78 153 ... 48 106 96 71 2911 215 1077 233 161 380 30413957
Values : 0 4 5 3 5 3 5 3 5 3 5 ... 9 5 9 7 0 4 5 4 2 4 0
$Chr2
integer-Rle of length 19698289 with 14 runs
Lengths: 1024 248 185 53 362 239 699 895 1808 268 164 625 102 19691617
Values : 0 5 3 5 3 5 4 0 3 0 3 0 5 0
$Chr3
integer-Rle of length 23459830 with 29 runs
Lengths: 1652 145 139 111 95 80 60 145 99 163 120 ... 182 477 285 35 289 108 55 155 148 156 23453781
Values : 0 4 5 3 5 3 5 3 5 3 5 ... 0 5 0 4 5 3 5 3 5 4 0
$Chr4
integer-Rle of length 18585056 with 72 runs
Lengths: 1179 357 1358 128 872 212 20 23 23 54 38 ... 179 132 134 84 19 114 36 212 114 74 18571697
Values : 0 5 0 5 3 6 7 9 7 5 7 ... 5 3 5 3 5 3 5 3 5 4 0
$Chr5
integer-Rle of length 26975502 with 64 runs
Lengths: 1222 28 28 109 72 67 45 75 98 36 133 ... 482 421 124 104 137 128 435 76 55 174 26967058
Values : 0 4 7 13 16 10 11 17 9 17 9 ... 5 3 5 3 5 3 5 3 5 4 0
...
<2 more elements>Overlap operations
Hits object with 55 hits and 0 metadata columns:
queryHits subjectHits
<integer> <integer>
[1] 1 1
[2] 1 2
[3] 1 4
[4] 1 3
[5] 2 1
... ... ...
[51] 16 1
[52] 16 2
[53] 16 3
[54] 17 1
[55] 17 2
-------
queryLength: 442 / subjectLength: 4 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41
4 4 4 4 3 4 3 3 3 3 3 3 3 3 3 3 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 GRanges object with 17 ranges and 10 metadata columns:
seqnames ranges strand | source type score phase ID Name Note Parent Index Derives_from
<Rle> <IRanges> <Rle> | <factor> <factor> <numeric> <integer> <character> <character> <CharacterList> <CharacterList> <character> <character>
2 Chr1 3631-5899 * | TAIR10 mRNA NA <NA> AT1G01010.1 AT1G01010.1 AT1G01010 1 <NA>
3 Chr1 3631-5899 * | TAIR10 mRNA NA <NA> AT1G01010.1 AT1G01010.1 AT1G01010 1 <NA>
4 Chr1 3760-5630 * | TAIR10 protein NA <NA> AT1G01010.1-Protein AT1G01010.1 <NA> AT1G01010.1
5 Chr1 3631-3913 * | TAIR10 exon NA <NA> <NA> <NA> AT1G01010.1 <NA> <NA>
6 Chr1 3631-3759 * | TAIR10 five_prime_UTR NA <NA> <NA> <NA> AT1G01010.1 <NA> <NA>
.. ... ... ... . ... ... ... ... ... ... ... ... ... ...
14 Chr1 5174-5326 * | TAIR10 exon NA <NA> <NA> <NA> AT1G01010.1 <NA> <NA>
15 Chr1 5174-5326 * | TAIR10 CDS NA 0 <NA> <NA> AT1G01010.1,AT1G01010.1-Protein <NA> <NA>
16 Chr1 5439-5899 * | TAIR10 exon NA <NA> <NA> <NA> AT1G01010.1 <NA> <NA>
17 Chr1 5439-5630 * | TAIR10 CDS NA 0 <NA> <NA> AT1G01010.1,AT1G01010.1-Protein <NA> <NA>
18 Chr1 5631-5899 * | TAIR10 three_prime_UTR NA <NA> <NA> <NA> AT1G01010.1 <NA> <NA>
-------
seqinfo: 7 sequences from an unspecified genomeTip
findOverlaps and subsetByOverlaps are among the most frequently used functions in genomic analyses — they power intersection of features with peaks, reads, SNPs, and any other range-based data.
GRangesList — list of GRanges objects
sp <- split(gff, seq(along=gff)) # one range per list component
split(gff, seqnames(gff)) # ranges grouped by chromosomeGRangesList object of length 7:
$Chr1
GRanges object with 71 ranges and 10 metadata columns:
seqnames ranges strand | source type score phase ID Name Note Parent Index Derives_from
<Rle> <IRanges> <Rle> | <factor> <factor> <numeric> <integer> <character> <character> <CharacterList> <CharacterList> <character> <character>
2 Chr1 3631-5899 * | TAIR10 mRNA NA <NA> AT1G01010.1 AT1G01010.1 AT1G01010 1 <NA>
3 Chr1 3631-5899 * | TAIR10 mRNA NA <NA> AT1G01010.1 AT1G01010.1 AT1G01010 1 <NA>
4 Chr1 3760-5630 * | TAIR10 protein NA <NA> AT1G01010.1-Protein AT1G01010.1 <NA> AT1G01010.1
5 Chr1 3631-3913 * | TAIR10 exon NA <NA> <NA> <NA> AT1G01010.1 <NA> <NA>
6 Chr1 3631-3759 * | TAIR10 five_prime_UTR NA <NA> <NA> <NA> AT1G01010.1 <NA> <NA>
.. ... ... ... . ... ... ... ... ... ... ... ... ... ...
68 Chr1 13335-13714 * | TAIR10 exon NA <NA> <NA> <NA> AT1G01030.1 <NA> <NA>
69 Chr1 12941-13173 * | TAIR10 five_prime_UTR NA <NA> <NA> <NA> AT1G01030.1 <NA> <NA>
70 Chr1 11864-12940 * | TAIR10 CDS NA 0 <NA> <NA> AT1G01030.1,AT1G01030.1-Protein <NA> <NA>
71 Chr1 11649-11863 * | TAIR10 three_prime_UTR NA <NA> <NA> <NA> AT1G01030.1 <NA> <NA>
72 Chr1 11649-13173 * | TAIR10 exon NA <NA> <NA> <NA> AT1G01030.1 <NA> <NA>
-------
seqinfo: 7 sequences from an unspecified genome
...
<6 more elements>GRanges object with 442 ranges and 10 metadata columns:
seqnames ranges strand | source type score phase ID Name Note Parent Index Derives_from
<Rle> <IRanges> <Rle> | <factor> <factor> <numeric> <integer> <character> <character> <CharacterList> <CharacterList> <character> <character>
1.2 Chr1 3631-5899 * | TAIR10 mRNA NA <NA> AT1G01010.1 AT1G01010.1 AT1G01010 1 <NA>
2.3 Chr1 3631-5899 * | TAIR10 mRNA NA <NA> AT1G01010.1 AT1G01010.1 AT1G01010 1 <NA>
3.4 Chr1 3760-5630 * | TAIR10 protein NA <NA> AT1G01010.1-Protein AT1G01010.1 <NA> AT1G01010.1
4.5 Chr1 3631-3913 * | TAIR10 exon NA <NA> <NA> <NA> AT1G01010.1 <NA> <NA>
5.6 Chr1 3631-3759 * | TAIR10 five_prime_UTR NA <NA> <NA> <NA> AT1G01010.1 <NA> <NA>
... ... ... ... . ... ... ... ... ... ... ... ... ... ...
438.445 ChrM 11918-12241 * | TAIR10 gene NA <NA> ATMG00030 ATMG00030 protein_coding_gene <NA> <NA>
439.446 ChrM 11918-12241 * | TAIR10 mRNA NA <NA> ATMG00030.1 ATMG00030.1 ATMG00030 1 <NA>
440.447 ChrM 11918-12241 * | TAIR10 protein NA <NA> ATMG00030.1-Protein ATMG00030.1 <NA> ATMG00030.1
441.448 ChrM 11918-12241 * | TAIR10 exon NA <NA> <NA> <NA> ATMG00030.1 <NA> <NA>
442.449 ChrM 11918-12241 * | TAIR10 CDS NA 0 <NA> <NA> ATMG00030.1,ATMG00030.1-Protein <NA> <NA>
-------
seqinfo: 7 sequences from an unspecified genomeGRangesList object of length 4:
$`1`
GRanges object with 1 range and 1 metadata column:
seqnames ranges strand | type
<Rle> <IRanges> <Rle> | <factor>
2 Chr1 3631-5899 * | mRNA
-------
seqinfo: 7 sequences from an unspecified genome
$`2`
GRanges object with 1 range and 1 metadata column:
seqnames ranges strand | type
<Rle> <IRanges> <Rle> | <factor>
3 Chr1 3631-5899 * | mRNA
-------
seqinfo: 7 sequences from an unspecified genome
$`3`
GRanges object with 1 range and 1 metadata column:
seqnames ranges strand | type
<Rle> <IRanges> <Rle> | <factor>
4 Chr1 3760-5630 * | protein
-------
seqinfo: 7 sequences from an unspecified genome
$`4`
GRanges object with 1 range and 1 metadata column:
seqnames ranges strand | type
<Rle> <IRanges> <Rle> | <factor>
5 Chr1 3631-3913 * | exon
-------
seqinfo: 7 sequences from an unspecified genome$`1`
[1] 1
$`2`
[1] 1
$`3`
[1] 1
$`4`
[1] 1Transcript Ranges — TxDb Databases
TxDb (TranscriptDb) objects store transcript, exon, and CDS ranges in a SQLite database — making annotation retrieval robust and convenient.
Build a TxDb from a GFF file
library(txdbmaker)
download.file(
"https://cluster.hpcc.ucr.edu/~tgirke/Documents/R_BioCond/Samples/gff3.gff",
"data/gff3.gff"
)
txdb <- makeTxDbFromGFF(
file = "data/gff3.gff",
format = "gff",
dataSource = "TAIR",
organism = "Arabidopsis thaliana"
)
saveDb(txdb, file="./data/TAIR10.sqlite") # save for reuseTxDb object:
# Db type: TxDb
# Supporting package: GenomicFeatures
# Data source: TAIR
# Organism: Arabidopsis thaliana
# Taxonomy ID: 3702
# Genome: NA
# Nb of transcripts: 28
# Db created by: txdbmaker package from Bioconductor
# Creation time: 2026-04-23 12:15:17 -0700 (Thu, 23 Apr 2026)
# txdbmaker version at creation time: 1.6.2
# RSQLite version at creation time: 2.4.6
# DBSCHEMAVERSION: 1.2txdb <- loadDb("./data/TAIR10.sqlite") # reload later
transcripts(txdb) # all transcripts as GRangesGRanges object with 28 ranges and 2 metadata columns:
seqnames ranges strand | tx_id tx_name
<Rle> <IRanges> <Rle> | <integer> <character>
[1] Chr1 3631-5899 + | 1 AT1G01010.1
[2] Chr1 5928-8737 - | 2 AT1G01020.1
[3] Chr1 6790-8737 - | 3 AT1G01020.2
[4] Chr1 11649-13714 - | 4 AT1G01030.1
[5] Chr2 1025-2810 + | 5 AT2G01008.1
... ... ... ... . ... ...
[24] ChrC 383-1444 - | 24 ATCG00020.1
[25] ChrC 1717-4347 - | 25 ATCG00030.1
[26] ChrM 11918-12241 + | 26 ATMG00030.1
[27] ChrM 273-734 - | 27 ATMG00010.1
[28] ChrM 8848-11415 - | 28 ATMG00020.1
-------
seqinfo: 7 sequences (2 circular) from an unspecified genome; no seqlengthsGRangesList object of length 22:
$AT1G01010
GRanges object with 1 range and 2 metadata columns:
seqnames ranges strand | tx_id tx_name
<Rle> <IRanges> <Rle> | <integer> <character>
[1] Chr1 3631-5899 + | 1 AT1G01010.1
-------
seqinfo: 7 sequences (2 circular) from an unspecified genome; no seqlengths
$AT1G01020
GRanges object with 2 ranges and 2 metadata columns:
seqnames ranges strand | tx_id tx_name
<Rle> <IRanges> <Rle> | <integer> <character>
[1] Chr1 5928-8737 - | 2 AT1G01020.1
[2] Chr1 6790-8737 - | 3 AT1G01020.2
-------
seqinfo: 7 sequences (2 circular) from an unspecified genome; no seqlengths
$AT1G01030
GRanges object with 1 range and 2 metadata columns:
seqnames ranges strand | tx_id tx_name
<Rle> <IRanges> <Rle> | <integer> <character>
[1] Chr1 11649-13714 - | 4 AT1G01030.1
-------
seqinfo: 7 sequences (2 circular) from an unspecified genome; no seqlengths
...
<19 more elements>GRangesList object of length 22:
$AT1G01010
GRanges object with 6 ranges and 2 metadata columns:
seqnames ranges strand | exon_id exon_name
<Rle> <IRanges> <Rle> | <integer> <character>
[1] Chr1 3631-3913 + | 1 <NA>
[2] Chr1 3996-4276 + | 2 <NA>
[3] Chr1 4486-4605 + | 3 <NA>
[4] Chr1 4706-5095 + | 4 <NA>
[5] Chr1 5174-5326 + | 5 <NA>
[6] Chr1 5439-5899 + | 6 <NA>
-------
seqinfo: 7 sequences (2 circular) from an unspecified genome; no seqlengths
$AT1G01020
GRanges object with 12 ranges and 2 metadata columns:
seqnames ranges strand | exon_id exon_name
<Rle> <IRanges> <Rle> | <integer> <character>
[1] Chr1 5928-6263 - | 7 <NA>
[2] Chr1 6437-7069 - | 8 <NA>
[3] Chr1 6790-7069 - | 9 <NA>
[4] Chr1 7157-7232 - | 10 <NA>
[5] Chr1 7157-7450 - | 11 <NA>
... ... ... ... . ... ...
[8] Chr1 7762-7835 - | 14 <NA>
[9] Chr1 7942-7987 - | 15 <NA>
[10] Chr1 8236-8325 - | 16 <NA>
[11] Chr1 8417-8464 - | 17 <NA>
[12] Chr1 8571-8737 - | 18 <NA>
-------
seqinfo: 7 sequences (2 circular) from an unspecified genome; no seqlengths
$AT1G01030
GRanges object with 2 ranges and 2 metadata columns:
seqnames ranges strand | exon_id exon_name
<Rle> <IRanges> <Rle> | <integer> <character>
[1] Chr1 11649-13173 - | 19 <NA>
[2] Chr1 13335-13714 - | 20 <NA>
-------
seqinfo: 7 sequences (2 circular) from an unspecified genome; no seqlengths
...
<19 more elements>Build a TxDb from BioMart
library(GenomicFeatures); library(txdbmaker); library(biomaRt)
txdb <- makeTxDbFromBiomart(
biomart = "plants_mart",
dataset = "athaliana_eg_gene",
host = "https://plants.ensembl.org"
)
# Explore BioMart databases
listMarts(host="plants.ensembl.org") biomart version
1 plants_mart Ensembl Plants Genes 62
2 plants_variations Ensembl Plants Variations 62mymart <- useMart("plants_mart", dataset="athaliana_eg_gene", host="plants.ensembl.org")
listAttributes(mymart) name description page
1 ensembl_gene_id Gene stable ID feature_page
2 ensembl_transcript_id Transcript stable ID feature_page
3 ensembl_peptide_id Protein stable ID feature_page
4 ensembl_exon_id Exon stable ID feature_page
5 description Gene description feature_page
6 chromosome_name Chromosome/scaffold name feature_page
7 start_position Gene start (bp) feature_page
8 end_position Gene end (bp) feature_page
9 strand Strand feature_page
10 band Karyotype band feature_page
11 transcript_start Transcript start (bp) feature_page
12 transcript_end Transcript end (bp) feature_page
13 transcription_start_site Transcription start site (TSS) feature_page
14 transcript_length Transcript length (including UTRs and CDS) feature_page
15 transcript_is_canonical Ensembl Canonical feature_page
16 external_gene_name Gene name feature_page
17 external_gene_source Source of gene name feature_page
18 external_transcript_name Transcript name feature_page
19 external_transcript_source_name Source of transcript name feature_page
20 transcript_count Transcript count feature_page
21 percentage_gene_gc_content Gene % GC content feature_page
22 gene_biotype Gene type feature_page
23 transcript_biotype Transcript type feature_page
24 source Source (gene) feature_page
25 transcript_source Source (transcript) feature_page
26 external_synonym Gene Synonym feature_page
27 go_id GO term accession feature_page
28 name_1006 GO term name feature_page
29 definition_1006 GO term definition feature_page
30 go_linkage_type GO term evidence code feature_page
31 namespace_1003 GO domain feature_page
32 po_id PO term accession (bp) feature_page
33 po_name_1006 PO term name (bp) feature_page
34 po_definition_1006 PO term definition (bp) feature_page
35 po_linkage_type PO term evidence code (bp) feature_page
36 po_namespace_1003 PO domain feature_page
37 goslim_goa_accession GOSlim GOA Accession(s) feature_page
38 goslim_goa_description GOSlim GOA Description feature_page
39 biogrid BioGRID Interaction data, The General Repository for Interaction Datasets ID feature_page
40 chembl ChEMBL ID feature_page
41 entrezgene_trans_name EntrezGene transcript name ID feature_page
42 embl European Nucleotide Archive ID feature_page
43 arrayexpress Expression Atlas ID feature_page
44 protein_id INSDC protein ID feature_page
45 knetminer_ara KNETMINER_ARA ID feature_page
46 merops MEROPS - the Peptidase Database ID feature_page
47 mirbase_id miRBase ID feature_page
48 mirbase_accession miRBase accession feature_page
49 mirbase_trans_name miRBase transcript name ID feature_page
50 nasc_gene_id NASC Gene ID feature_page
51 entrezgene_description NCBI gene (formerly Entrezgene) description feature_page
52 entrezgene_accession NCBI gene (formerly Entrezgene) accession feature_page
53 entrezgene_id NCBI gene (formerly Entrezgene) ID feature_page
54 pdb PDB ID feature_page
55 plant_reactome_pathway Plant Reactome Pathway ID feature_page
56 plant_reactome_reaction Plant Reactome Reaction ID feature_page
57 po Plant Structure Ontology ID feature_page
58 refseq_dna RefSeq DNA ID feature_page
59 refseq_mrna RefSeq mRNA ID feature_page
60 refseq_ncrna RefSeq ncRNA ID feature_page
61 refseq_peptide RefSeq peptide ID feature_page
62 rnacentral RNAcentral ID feature_page
63 string STRING ID feature_page
64 tair_locus TAIR ID feature_page
65 tair_symbol TAIR Gene Name ID feature_page
66 tair_locus_model TAIR Locus (Model) ID feature_page
67 tair_translation TAIR Translation identifier ID feature_page
68 uniparc UniParc ID feature_page
69 uniprot_gn_trans_name UniProt transcript name ID feature_page
70 uniprot_gn_id UniProtKB Gene Name ID feature_page
71 uniprot_gn_symbol UniProtKB Gene Name symbol feature_page
72 uniprotswissprot UniProtKB/Swiss-Prot ID feature_page
73 uniprotsptrembl UniProtKB/TrEMBL ID feature_page
74 wikigene_id WikiGene ID feature_page
75 wikigene_name WikiGene name feature_page
76 wikigene_description WikiGene description feature_page
77 cdd CDD ID feature_page
78 cdd_start CDD start feature_page
79 cdd_end CDD end feature_page
80 gene3d Gene3D ID feature_page
81 gene3d_start Gene3D start feature_page
82 gene3d_end Gene3D end feature_page
83 hamap HAMAP ID feature_page
84 hamap_start HAMAP start feature_page
85 hamap_end HAMAP end feature_page
86 ncbifam NCBIFAM ID feature_page
87 ncbifam_start NCBIFAM start feature_page
88 ncbifam_end NCBIFAM end feature_page
89 hmmpanther PANTHER ID feature_page
90 hmmpanther_start PANTHER start feature_page
91 hmmpanther_end PANTHER end feature_page
92 pfam Pfam ID feature_page
93 pfam_start Pfam start feature_page
94 pfam_end Pfam end feature_page
95 pirsf PIRSF ID feature_page
96 pirsf_start PIRSF start feature_page
97 pirsf_end PIRSF end feature_page
98 prints Prints ID feature_page
99 prints_start Prints start feature_page
100 prints_end Prints end feature_page
101 scanprosite PROSITE patterns ID feature_page
102 scanprosite_start PROSITE patterns start feature_page
103 scanprosite_end PROSITE patterns end feature_page
104 pfscan PROSITE profiles ID feature_page
105 pfscan_start PROSITE profiles start feature_page
106 pfscan_end PROSITE profiles end feature_page
107 sfld SFLD ID feature_page
108 sfld_start SFLD start feature_page
109 sfld_end SFLD end feature_page
110 smart SMART ID feature_page
111 smart_start SMART start feature_page
112 smart_end SMART end feature_page
113 superfamily Superfamily ID feature_page
114 superfamily_start Superfamily start feature_page
115 superfamily_end Superfamily end feature_page
116 tigrfam TIGRFAM ID feature_page
117 tigrfam_start TIGRFAM start feature_page
118 tigrfam_end TIGRFAM end feature_page
119 interpro Interpro ID feature_page
120 interpro_short_description Interpro Short Description feature_page
121 interpro_description Interpro Description feature_page
122 interpro_start Interpro start feature_page
123 interpro_end Interpro end feature_page
124 alphafold AFDB-ENSP mappings feature_page
125 alphafold_start AFDB-ENSP mappings start feature_page
126 alphafold_end AFDB-ENSP mappings end feature_page
127 mobidblite MobiDB lite feature_page
128 mobidblite_start MobiDB lite start feature_page
129 mobidblite_end MobiDB lite end feature_page
130 ncoils Coiled-coils (Ncoils) feature_page
131 ncoils_start Coiled-coils (Ncoils) start feature_page
132 ncoils_end Coiled-coils (Ncoils) end feature_page
133 phobius Phobius feature_page
134 phobius_start Phobius start feature_page
135 phobius_end Phobius end feature_page
136 seg Low complexity (Seg) feature_page
137 seg_start Low complexity (Seg) start feature_page
138 seg_end Low complexity (Seg) end feature_page
139 signalp Cleavage site (Signalp) feature_page
140 signalp_start Cleavage site (Signalp) start feature_page
141 signalp_end Cleavage site (Signalp) end feature_page
142 signalp_gn SignalP_GRAM_NEGATIVE feature_page
143 signalp_gn_start SignalP_GRAM_NEGATIVE start feature_page
144 signalp_gn_end SignalP_GRAM_NEGATIVE end feature_page
145 signalp_gp SignalP_GRAM_POSITIVE feature_page
146 signalp_gp_start SignalP_GRAM_POSITIVE start feature_page
147 signalp_gp_end SignalP_GRAM_POSITIVE end feature_page
148 tmhmm Transmembrane helices feature_page
149 tmhmm_start Transmembrane helices start feature_page
150 tmhmm_end Transmembrane helices end feature_page
151 ensembl_gene_id Gene stable ID structure
152 ensembl_transcript_id Transcript stable ID structure
153 ensembl_peptide_id Protein stable ID structure
154 chromosome_name Chromosome/scaffold name structure
155 start_position Gene start (bp) structure
156 end_position Gene end (bp) structure
157 transcript_start Transcript start (bp) structure
158 transcript_end Transcript end (bp) structure
159 transcription_start_site Transcription start site (TSS) structure
160 transcript_length Transcript length (including UTRs and CDS) structure
161 strand Strand structure
162 external_gene_name Gene name structure
163 external_gene_source Source of gene name structure
164 5_utr_start 5' UTR start structure
165 5_utr_end 5' UTR end structure
166 3_utr_start 3' UTR start structure
167 3_utr_end 3' UTR end structure
168 cds_length CDS Length structure
169 transcript_count Transcript count structure
170 description Gene description structure
171 gene_biotype Gene type structure
172 exon_chrom_start Exon region start (bp) structure
173 exon_chrom_end Exon region end (bp) structure
174 is_constitutive Constitutive exon structure
175 rank Exon rank in transcript structure
176 phase Start phase structure
177 end_phase End phase structure
178 cdna_coding_start cDNA coding start structure
179 cdna_coding_end cDNA coding end structure
180 genomic_coding_start Genomic coding start structure
181 genomic_coding_end Genomic coding end structure
182 ensembl_exon_id Exon stable ID structure
183 cds_start CDS start structure
184 cds_end CDS end structure
185 ensembl_gene_id Gene stable ID homologs
186 ensembl_transcript_id Transcript stable ID homologs
187 ensembl_peptide_id Protein stable ID homologs
188 chromosome_name Chromosome/scaffold name homologs
189 start_position Gene start (bp) homologs
190 end_position Gene end (bp) homologs
191 strand Strand homologs
192 band Karyotype band homologs
193 external_gene_name Gene name homologs
194 external_gene_source Source of gene name homologs
195 transcript_count Transcript count homologs
196 percentage_gene_gc_content Gene % GC content homologs
197 description Gene description homologs
198 achinensis_eg_homolog_ensembl_gene Actinidia chinensis gene stable ID homologs
199 achinensis_eg_homolog_associated_gene_name Actinidia chinensis gene name homologs
200 achinensis_eg_homolog_ensembl_peptide Actinidia chinensis protein or transcript stable ID homologs
201 achinensis_eg_homolog_chromosome Actinidia chinensis chromosome/scaffold name homologs
202 achinensis_eg_homolog_chrom_start Actinidia chinensis chromosome/scaffold start (bp) homologs
203 achinensis_eg_homolog_chrom_end Actinidia chinensis chromosome/scaffold end (bp) homologs
204 achinensis_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
205 achinensis_eg_homolog_subtype Last common ancestor with Actinidia chinensis homologs
206 achinensis_eg_homolog_orthology_type Actinidia chinensis homology type homologs
207 achinensis_eg_homolog_perc_id %id. target Actinidia chinensis gene identical to query gene homologs
208 achinensis_eg_homolog_perc_id_r1 %id. query gene identical to target Actinidia chinensis gene homologs
209 achinensis_eg_homolog_wga_coverage Actinidia chinensis Whole-genome alignment coverage homologs
210 achinensis_eg_homolog_orthology_confidence Actinidia chinensis orthology confidence [0 low, 1 high] homologs
211 atauschii_eg_homolog_ensembl_gene Aegilops tauschii gene stable ID homologs
212 atauschii_eg_homolog_associated_gene_name Aegilops tauschii gene name homologs
213 atauschii_eg_homolog_ensembl_peptide Aegilops tauschii protein or transcript stable ID homologs
214 atauschii_eg_homolog_chromosome Aegilops tauschii chromosome/scaffold name homologs
215 atauschii_eg_homolog_chrom_start Aegilops tauschii chromosome/scaffold start (bp) homologs
216 atauschii_eg_homolog_chrom_end Aegilops tauschii chromosome/scaffold end (bp) homologs
217 atauschii_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
218 atauschii_eg_homolog_subtype Last common ancestor with Aegilops tauschii homologs
219 atauschii_eg_homolog_orthology_type Aegilops tauschii homology type homologs
220 atauschii_eg_homolog_perc_id %id. target Aegilops tauschii gene identical to query gene homologs
221 atauschii_eg_homolog_perc_id_r1 %id. query gene identical to target Aegilops tauschii gene homologs
222 atauschii_eg_homolog_wga_coverage Aegilops tauschii Whole-genome alignment coverage homologs
223 atauschii_eg_homolog_orthology_confidence Aegilops tauschii orthology confidence [0 low, 1 high] homologs
224 aumbellulata_eg_homolog_ensembl_gene Aegilops umbellulata gene stable ID homologs
225 aumbellulata_eg_homolog_associated_gene_name Aegilops umbellulata gene name homologs
226 aumbellulata_eg_homolog_ensembl_peptide Aegilops umbellulata protein or transcript stable ID homologs
227 aumbellulata_eg_homolog_chromosome Aegilops umbellulata chromosome/scaffold name homologs
228 aumbellulata_eg_homolog_chrom_start Aegilops umbellulata chromosome/scaffold start (bp) homologs
229 aumbellulata_eg_homolog_chrom_end Aegilops umbellulata chromosome/scaffold end (bp) homologs
230 aumbellulata_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
231 aumbellulata_eg_homolog_subtype Last common ancestor with Aegilops umbellulata homologs
232 aumbellulata_eg_homolog_orthology_type Aegilops umbellulata homology type homologs
233 aumbellulata_eg_homolog_perc_id %id. target Aegilops umbellulata gene identical to query gene homologs
234 aumbellulata_eg_homolog_perc_id_r1 %id. query gene identical to target Aegilops umbellulata gene homologs
235 aumbellulata_eg_homolog_orthology_confidence Aegilops umbellulata orthology confidence [0 low, 1 high] homologs
236 atrichopoda_eg_homolog_ensembl_gene Amborella trichopoda gene stable ID homologs
237 atrichopoda_eg_homolog_associated_gene_name Amborella trichopoda gene name homologs
238 atrichopoda_eg_homolog_ensembl_peptide Amborella trichopoda protein or transcript stable ID homologs
239 atrichopoda_eg_homolog_chromosome Amborella trichopoda chromosome/scaffold name homologs
240 atrichopoda_eg_homolog_chrom_start Amborella trichopoda chromosome/scaffold start (bp) homologs
241 atrichopoda_eg_homolog_chrom_end Amborella trichopoda chromosome/scaffold end (bp) homologs
242 atrichopoda_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
243 atrichopoda_eg_homolog_subtype Last common ancestor with Amborella trichopoda homologs
244 atrichopoda_eg_homolog_orthology_type Amborella trichopoda homology type homologs
245 atrichopoda_eg_homolog_perc_id %id. target Amborella trichopoda gene identical to query gene homologs
246 atrichopoda_eg_homolog_perc_id_r1 %id. query gene identical to target Amborella trichopoda gene homologs
247 atrichopoda_eg_homolog_wga_coverage Amborella trichopoda Whole-genome alignment coverage homologs
248 atrichopoda_eg_homolog_orthology_confidence Amborella trichopoda orthology confidence [0 low, 1 high] homologs
249 acomosus_eg_homolog_ensembl_gene Ananas comosus gene stable ID homologs
250 acomosus_eg_homolog_associated_gene_name Ananas comosus gene name homologs
251 acomosus_eg_homolog_ensembl_peptide Ananas comosus protein or transcript stable ID homologs
252 acomosus_eg_homolog_chromosome Ananas comosus chromosome/scaffold name homologs
253 acomosus_eg_homolog_chrom_start Ananas comosus chromosome/scaffold start (bp) homologs
254 acomosus_eg_homolog_chrom_end Ananas comosus chromosome/scaffold end (bp) homologs
255 acomosus_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
256 acomosus_eg_homolog_subtype Last common ancestor with Ananas comosus homologs
257 acomosus_eg_homolog_orthology_type Ananas comosus homology type homologs
258 acomosus_eg_homolog_perc_id %id. target Ananas comosus gene identical to query gene homologs
259 acomosus_eg_homolog_perc_id_r1 %id. query gene identical to target Ananas comosus gene homologs
260 acomosus_eg_homolog_wga_coverage Ananas comosus Whole-genome alignment coverage homologs
261 acomosus_eg_homolog_orthology_confidence Ananas comosus orthology confidence [0 low, 1 high] homologs
262 ahalleri_eg_homolog_ensembl_gene Arabidopsis halleri gene stable ID homologs
263 ahalleri_eg_homolog_associated_gene_name Arabidopsis halleri gene name homologs
264 ahalleri_eg_homolog_ensembl_peptide Arabidopsis halleri protein or transcript stable ID homologs
265 ahalleri_eg_homolog_chromosome Arabidopsis halleri chromosome/scaffold name homologs
266 ahalleri_eg_homolog_chrom_start Arabidopsis halleri chromosome/scaffold start (bp) homologs
267 ahalleri_eg_homolog_chrom_end Arabidopsis halleri chromosome/scaffold end (bp) homologs
268 ahalleri_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
269 ahalleri_eg_homolog_subtype Last common ancestor with Arabidopsis halleri homologs
270 ahalleri_eg_homolog_orthology_type Arabidopsis halleri homology type homologs
271 ahalleri_eg_homolog_perc_id %id. target Arabidopsis halleri gene identical to query gene homologs
272 ahalleri_eg_homolog_perc_id_r1 %id. query gene identical to target Arabidopsis halleri gene homologs
273 ahalleri_eg_homolog_goc_score Arabidopsis halleri Gene-order conservation score homologs
274 ahalleri_eg_homolog_wga_coverage Arabidopsis halleri Whole-genome alignment coverage homologs
275 ahalleri_eg_homolog_orthology_confidence Arabidopsis halleri orthology confidence [0 low, 1 high] homologs
276 alyrata_eg_homolog_ensembl_gene Arabidopsis lyrata gene stable ID homologs
277 alyrata_eg_homolog_associated_gene_name Arabidopsis lyrata gene name homologs
278 alyrata_eg_homolog_ensembl_peptide Arabidopsis lyrata protein or transcript stable ID homologs
279 alyrata_eg_homolog_chromosome Arabidopsis lyrata chromosome/scaffold name homologs
280 alyrata_eg_homolog_chrom_start Arabidopsis lyrata chromosome/scaffold start (bp) homologs
281 alyrata_eg_homolog_chrom_end Arabidopsis lyrata chromosome/scaffold end (bp) homologs
282 alyrata_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
283 alyrata_eg_homolog_subtype Last common ancestor with Arabidopsis lyrata homologs
284 alyrata_eg_homolog_orthology_type Arabidopsis lyrata homology type homologs
285 alyrata_eg_homolog_perc_id %id. target Arabidopsis lyrata gene identical to query gene homologs
286 alyrata_eg_homolog_perc_id_r1 %id. query gene identical to target Arabidopsis lyrata gene homologs
287 alyrata_eg_homolog_goc_score Arabidopsis lyrata Gene-order conservation score homologs
288 alyrata_eg_homolog_wga_coverage Arabidopsis lyrata Whole-genome alignment coverage homologs
289 alyrata_eg_homolog_orthology_confidence Arabidopsis lyrata orthology confidence [0 low, 1 high] homologs
290 aalpina_eg_homolog_ensembl_gene Arabis alpina gene stable ID homologs
291 aalpina_eg_homolog_associated_gene_name Arabis alpina gene name homologs
292 aalpina_eg_homolog_ensembl_peptide Arabis alpina protein or transcript stable ID homologs
293 aalpina_eg_homolog_chromosome Arabis alpina chromosome/scaffold name homologs
294 aalpina_eg_homolog_chrom_start Arabis alpina chromosome/scaffold start (bp) homologs
295 aalpina_eg_homolog_chrom_end Arabis alpina chromosome/scaffold end (bp) homologs
296 aalpina_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
297 aalpina_eg_homolog_subtype Last common ancestor with Arabis alpina homologs
298 aalpina_eg_homolog_orthology_type Arabis alpina homology type homologs
299 aalpina_eg_homolog_perc_id %id. target Arabis alpina gene identical to query gene homologs
300 aalpina_eg_homolog_perc_id_r1 %id. query gene identical to target Arabis alpina gene homologs
301 aalpina_eg_homolog_goc_score Arabis alpina Gene-order conservation score homologs
302 aalpina_eg_homolog_wga_coverage Arabis alpina Whole-genome alignment coverage homologs
303 aalpina_eg_homolog_orthology_confidence Arabis alpina orthology confidence [0 low, 1 high] homologs
304 ahypogaea_eg_homolog_ensembl_gene Arachis hypogaea gene stable ID homologs
305 ahypogaea_eg_homolog_associated_gene_name Arachis hypogaea gene name homologs
306 ahypogaea_eg_homolog_ensembl_peptide Arachis hypogaea protein or transcript stable ID homologs
307 ahypogaea_eg_homolog_chromosome Arachis hypogaea chromosome/scaffold name homologs
308 ahypogaea_eg_homolog_chrom_start Arachis hypogaea chromosome/scaffold start (bp) homologs
309 ahypogaea_eg_homolog_chrom_end Arachis hypogaea chromosome/scaffold end (bp) homologs
310 ahypogaea_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
311 ahypogaea_eg_homolog_subtype Last common ancestor with Arachis hypogaea homologs
312 ahypogaea_eg_homolog_orthology_type Arachis hypogaea homology type homologs
313 ahypogaea_eg_homolog_perc_id %id. target Arachis hypogaea gene identical to query gene homologs
314 ahypogaea_eg_homolog_perc_id_r1 %id. query gene identical to target Arachis hypogaea gene homologs
315 ahypogaea_eg_homolog_orthology_confidence Arachis hypogaea orthology confidence [0 low, 1 high] homologs
316 aofficinalis_eg_homolog_ensembl_gene Asparagus officinalis gene stable ID homologs
317 aofficinalis_eg_homolog_associated_gene_name Asparagus officinalis gene name homologs
318 aofficinalis_eg_homolog_ensembl_peptide Asparagus officinalis protein or transcript stable ID homologs
319 aofficinalis_eg_homolog_chromosome Asparagus officinalis chromosome/scaffold name homologs
320 aofficinalis_eg_homolog_chrom_start Asparagus officinalis chromosome/scaffold start (bp) homologs
321 aofficinalis_eg_homolog_chrom_end Asparagus officinalis chromosome/scaffold end (bp) homologs
322 aofficinalis_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
323 aofficinalis_eg_homolog_subtype Last common ancestor with Asparagus officinalis homologs
324 aofficinalis_eg_homolog_orthology_type Asparagus officinalis homology type homologs
325 aofficinalis_eg_homolog_perc_id %id. target Asparagus officinalis gene identical to query gene homologs
326 aofficinalis_eg_homolog_perc_id_r1 %id. query gene identical to target Asparagus officinalis gene homologs
327 aofficinalis_eg_homolog_orthology_confidence Asparagus officinalis orthology confidence [0 low, 1 high] homologs
328 asot3098_eg_homolog_ensembl_gene Avena sativa OT3098 gene stable ID homologs
329 asot3098_eg_homolog_associated_gene_name Avena sativa OT3098 gene name homologs
330 asot3098_eg_homolog_ensembl_peptide Avena sativa OT3098 protein or transcript stable ID homologs
331 asot3098_eg_homolog_chromosome Avena sativa OT3098 chromosome/scaffold name homologs
332 asot3098_eg_homolog_chrom_start Avena sativa OT3098 chromosome/scaffold start (bp) homologs
333 asot3098_eg_homolog_chrom_end Avena sativa OT3098 chromosome/scaffold end (bp) homologs
334 asot3098_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
335 asot3098_eg_homolog_subtype Last common ancestor with Avena sativa OT3098 homologs
336 asot3098_eg_homolog_orthology_type Avena sativa OT3098 homology type homologs
337 asot3098_eg_homolog_perc_id %id. target Avena sativa OT3098 gene identical to query gene homologs
338 asot3098_eg_homolog_perc_id_r1 %id. query gene identical to target Avena sativa OT3098 gene homologs
339 asot3098_eg_homolog_orthology_confidence Avena sativa OT3098 orthology confidence [0 low, 1 high] homologs
340 assang_eg_homolog_ensembl_gene Avena sativa Sang gene stable ID homologs
341 assang_eg_homolog_associated_gene_name Avena sativa Sang gene name homologs
342 assang_eg_homolog_ensembl_peptide Avena sativa Sang protein or transcript stable ID homologs
343 assang_eg_homolog_chromosome Avena sativa Sang chromosome/scaffold name homologs
344 assang_eg_homolog_chrom_start Avena sativa Sang chromosome/scaffold start (bp) homologs
345 assang_eg_homolog_chrom_end Avena sativa Sang chromosome/scaffold end (bp) homologs
346 assang_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
347 assang_eg_homolog_subtype Last common ancestor with Avena sativa Sang homologs
348 assang_eg_homolog_orthology_type Avena sativa Sang homology type homologs
349 assang_eg_homolog_perc_id %id. target Avena sativa Sang gene identical to query gene homologs
350 assang_eg_homolog_perc_id_r1 %id. query gene identical to target Avena sativa Sang gene homologs
351 assang_eg_homolog_orthology_confidence Avena sativa Sang orthology confidence [0 low, 1 high] homologs
352 bvulgaris_eg_homolog_ensembl_gene Beta vulgaris gene stable ID homologs
353 bvulgaris_eg_homolog_associated_gene_name Beta vulgaris gene name homologs
354 bvulgaris_eg_homolog_ensembl_peptide Beta vulgaris protein or transcript stable ID homologs
355 bvulgaris_eg_homolog_chromosome Beta vulgaris chromosome/scaffold name homologs
356 bvulgaris_eg_homolog_chrom_start Beta vulgaris chromosome/scaffold start (bp) homologs
357 bvulgaris_eg_homolog_chrom_end Beta vulgaris chromosome/scaffold end (bp) homologs
358 bvulgaris_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
359 bvulgaris_eg_homolog_subtype Last common ancestor with Beta vulgaris homologs
360 bvulgaris_eg_homolog_orthology_type Beta vulgaris homology type homologs
361 bvulgaris_eg_homolog_perc_id %id. target Beta vulgaris gene identical to query gene homologs
362 bvulgaris_eg_homolog_perc_id_r1 %id. query gene identical to target Beta vulgaris gene homologs
363 bvulgaris_eg_homolog_wga_coverage Beta vulgaris Whole-genome alignment coverage homologs
364 bvulgaris_eg_homolog_orthology_confidence Beta vulgaris orthology confidence [0 low, 1 high] homologs
365 bdistachyon_eg_homolog_ensembl_gene Brachypodium distachyon gene stable ID homologs
366 bdistachyon_eg_homolog_associated_gene_name Brachypodium distachyon gene name homologs
367 bdistachyon_eg_homolog_ensembl_peptide Brachypodium distachyon protein or transcript stable ID homologs
368 bdistachyon_eg_homolog_chromosome Brachypodium distachyon chromosome/scaffold name homologs
369 bdistachyon_eg_homolog_chrom_start Brachypodium distachyon chromosome/scaffold start (bp) homologs
370 bdistachyon_eg_homolog_chrom_end Brachypodium distachyon chromosome/scaffold end (bp) homologs
371 bdistachyon_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
372 bdistachyon_eg_homolog_subtype Last common ancestor with Brachypodium distachyon homologs
373 bdistachyon_eg_homolog_orthology_type Brachypodium distachyon homology type homologs
374 bdistachyon_eg_homolog_perc_id %id. target Brachypodium distachyon gene identical to query gene homologs
375 bdistachyon_eg_homolog_perc_id_r1 %id. query gene identical to target Brachypodium distachyon gene homologs
376 bdistachyon_eg_homolog_wga_coverage Brachypodium distachyon Whole-genome alignment coverage homologs
377 bdistachyon_eg_homolog_orthology_confidence Brachypodium distachyon orthology confidence [0 low, 1 high] homologs
378 bjuncea_eg_homolog_ensembl_gene Brassica juncea gene stable ID homologs
379 bjuncea_eg_homolog_associated_gene_name Brassica juncea gene name homologs
380 bjuncea_eg_homolog_ensembl_peptide Brassica juncea protein or transcript stable ID homologs
381 bjuncea_eg_homolog_chromosome Brassica juncea chromosome/scaffold name homologs
382 bjuncea_eg_homolog_chrom_start Brassica juncea chromosome/scaffold start (bp) homologs
383 bjuncea_eg_homolog_chrom_end Brassica juncea chromosome/scaffold end (bp) homologs
384 bjuncea_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
385 bjuncea_eg_homolog_subtype Last common ancestor with Brassica juncea homologs
386 bjuncea_eg_homolog_orthology_type Brassica juncea homology type homologs
387 bjuncea_eg_homolog_perc_id %id. target Brassica juncea gene identical to query gene homologs
388 bjuncea_eg_homolog_perc_id_r1 %id. query gene identical to target Brassica juncea gene homologs
389 bjuncea_eg_homolog_goc_score Brassica juncea Gene-order conservation score homologs
390 bjuncea_eg_homolog_wga_coverage Brassica juncea Whole-genome alignment coverage homologs
391 bjuncea_eg_homolog_orthology_confidence Brassica juncea orthology confidence [0 low, 1 high] homologs
392 bnapus_eg_homolog_ensembl_gene Brassica napus gene stable ID homologs
393 bnapus_eg_homolog_associated_gene_name Brassica napus gene name homologs
394 bnapus_eg_homolog_ensembl_peptide Brassica napus protein or transcript stable ID homologs
395 bnapus_eg_homolog_chromosome Brassica napus chromosome/scaffold name homologs
396 bnapus_eg_homolog_chrom_start Brassica napus chromosome/scaffold start (bp) homologs
397 bnapus_eg_homolog_chrom_end Brassica napus chromosome/scaffold end (bp) homologs
398 bnapus_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
399 bnapus_eg_homolog_subtype Last common ancestor with Brassica napus homologs
400 bnapus_eg_homolog_orthology_type Brassica napus homology type homologs
401 bnapus_eg_homolog_perc_id %id. target Brassica napus gene identical to query gene homologs
402 bnapus_eg_homolog_perc_id_r1 %id. query gene identical to target Brassica napus gene homologs
403 bnapus_eg_homolog_goc_score Brassica napus Gene-order conservation score homologs
404 bnapus_eg_homolog_wga_coverage Brassica napus Whole-genome alignment coverage homologs
405 bnapus_eg_homolog_orthology_confidence Brassica napus orthology confidence [0 low, 1 high] homologs
406 boleracea_eg_homolog_ensembl_gene Brassica oleracea gene stable ID homologs
407 boleracea_eg_homolog_associated_gene_name Brassica oleracea gene name homologs
408 boleracea_eg_homolog_ensembl_peptide Brassica oleracea protein or transcript stable ID homologs
409 boleracea_eg_homolog_chromosome Brassica oleracea chromosome/scaffold name homologs
410 boleracea_eg_homolog_chrom_start Brassica oleracea chromosome/scaffold start (bp) homologs
411 boleracea_eg_homolog_chrom_end Brassica oleracea chromosome/scaffold end (bp) homologs
412 boleracea_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
413 boleracea_eg_homolog_subtype Last common ancestor with Brassica oleracea homologs
414 boleracea_eg_homolog_orthology_type Brassica oleracea homology type homologs
415 boleracea_eg_homolog_perc_id %id. target Brassica oleracea gene identical to query gene homologs
416 boleracea_eg_homolog_perc_id_r1 %id. query gene identical to target Brassica oleracea gene homologs
417 boleracea_eg_homolog_goc_score Brassica oleracea Gene-order conservation score homologs
418 boleracea_eg_homolog_wga_coverage Brassica oleracea Whole-genome alignment coverage homologs
419 boleracea_eg_homolog_orthology_confidence Brassica oleracea orthology confidence [0 low, 1 high] homologs
420 brro18_eg_homolog_ensembl_gene Brassica rapa R-o-18 gene stable ID homologs
421 brro18_eg_homolog_associated_gene_name Brassica rapa R-o-18 gene name homologs
422 brro18_eg_homolog_ensembl_peptide Brassica rapa R-o-18 protein or transcript stable ID homologs
423 brro18_eg_homolog_chromosome Brassica rapa R-o-18 chromosome/scaffold name homologs
424 brro18_eg_homolog_chrom_start Brassica rapa R-o-18 chromosome/scaffold start (bp) homologs
425 brro18_eg_homolog_chrom_end Brassica rapa R-o-18 chromosome/scaffold end (bp) homologs
426 brro18_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
427 brro18_eg_homolog_subtype Last common ancestor with Brassica rapa R-o-18 homologs
428 brro18_eg_homolog_orthology_type Brassica rapa R-o-18 homology type homologs
429 brro18_eg_homolog_perc_id %id. target Brassica rapa R-o-18 gene identical to query gene homologs
430 brro18_eg_homolog_perc_id_r1 %id. query gene identical to target Brassica rapa R-o-18 gene homologs
431 brro18_eg_homolog_goc_score Brassica rapa R-o-18 Gene-order conservation score homologs
432 brro18_eg_homolog_wga_coverage Brassica rapa R-o-18 Whole-genome alignment coverage homologs
433 brro18_eg_homolog_orthology_confidence Brassica rapa R-o-18 orthology confidence [0 low, 1 high] homologs
434 ccajan_eg_homolog_ensembl_gene Cajanus cajan (pigeon pea) - GCA_000340665.1 gene stable ID homologs
435 ccajan_eg_homolog_associated_gene_name Cajanus cajan (pigeon pea) - GCA_000340665.1 gene name homologs
436 ccajan_eg_homolog_ensembl_peptide Cajanus cajan (pigeon pea) - GCA_000340665.1 protein or transcript stable ID homologs
437 ccajan_eg_homolog_chromosome Cajanus cajan (pigeon pea) - GCA_000340665.1 chromosome/scaffold name homologs
438 ccajan_eg_homolog_chrom_start Cajanus cajan (pigeon pea) - GCA_000340665.1 chromosome/scaffold start (bp) homologs
439 ccajan_eg_homolog_chrom_end Cajanus cajan (pigeon pea) - GCA_000340665.1 chromosome/scaffold end (bp) homologs
440 ccajan_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
441 ccajan_eg_homolog_subtype Last common ancestor with Cajanus cajan (pigeon pea) - GCA_000340665.1 homologs
442 ccajan_eg_homolog_orthology_type Cajanus cajan (pigeon pea) - GCA_000340665.1 homology type homologs
443 ccajan_eg_homolog_perc_id %id. target Cajanus cajan (pigeon pea) - GCA_000340665.1 gene identical to query gene homologs
444 ccajan_eg_homolog_perc_id_r1 %id. query gene identical to target Cajanus cajan (pigeon pea) - GCA_000340665.1 gene homologs
445 ccajan_eg_homolog_orthology_confidence Cajanus cajan (pigeon pea) - GCA_000340665.1 orthology confidence [0 low, 1 high] homologs
446 csativa_eg_homolog_ensembl_gene Camelina sativa gene stable ID homologs
447 csativa_eg_homolog_associated_gene_name Camelina sativa gene name homologs
448 csativa_eg_homolog_ensembl_peptide Camelina sativa protein or transcript stable ID homologs
449 csativa_eg_homolog_chromosome Camelina sativa chromosome/scaffold name homologs
450 csativa_eg_homolog_chrom_start Camelina sativa chromosome/scaffold start (bp) homologs
451 csativa_eg_homolog_chrom_end Camelina sativa chromosome/scaffold end (bp) homologs
452 csativa_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
453 csativa_eg_homolog_subtype Last common ancestor with Camelina sativa homologs
454 csativa_eg_homolog_orthology_type Camelina sativa homology type homologs
455 csativa_eg_homolog_perc_id %id. target Camelina sativa gene identical to query gene homologs
456 csativa_eg_homolog_perc_id_r1 %id. query gene identical to target Camelina sativa gene homologs
457 csativa_eg_homolog_goc_score Camelina sativa Gene-order conservation score homologs
458 csativa_eg_homolog_wga_coverage Camelina sativa Whole-genome alignment coverage homologs
459 csativa_eg_homolog_orthology_confidence Camelina sativa orthology confidence [0 low, 1 high] homologs
460 csfemale_eg_homolog_ensembl_gene Cannabis sativa female gene stable ID homologs
461 csfemale_eg_homolog_associated_gene_name Cannabis sativa female gene name homologs
462 csfemale_eg_homolog_ensembl_peptide Cannabis sativa female protein or transcript stable ID homologs
463 csfemale_eg_homolog_chromosome Cannabis sativa female chromosome/scaffold name homologs
464 csfemale_eg_homolog_chrom_start Cannabis sativa female chromosome/scaffold start (bp) homologs
465 csfemale_eg_homolog_chrom_end Cannabis sativa female chromosome/scaffold end (bp) homologs
466 csfemale_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
467 csfemale_eg_homolog_subtype Last common ancestor with Cannabis sativa female homologs
468 csfemale_eg_homolog_orthology_type Cannabis sativa female homology type homologs
469 csfemale_eg_homolog_perc_id %id. target Cannabis sativa female gene identical to query gene homologs
470 csfemale_eg_homolog_perc_id_r1 %id. query gene identical to target Cannabis sativa female gene homologs
471 csfemale_eg_homolog_wga_coverage Cannabis sativa female Whole-genome alignment coverage homologs
472 csfemale_eg_homolog_orthology_confidence Cannabis sativa female orthology confidence [0 low, 1 high] homologs
473 cannuum_eg_homolog_ensembl_gene Capsicum annuum gene stable ID homologs
474 cannuum_eg_homolog_associated_gene_name Capsicum annuum gene name homologs
475 cannuum_eg_homolog_ensembl_peptide Capsicum annuum protein or transcript stable ID homologs
476 cannuum_eg_homolog_chromosome Capsicum annuum chromosome/scaffold name homologs
477 cannuum_eg_homolog_chrom_start Capsicum annuum chromosome/scaffold start (bp) homologs
478 cannuum_eg_homolog_chrom_end Capsicum annuum chromosome/scaffold end (bp) homologs
479 cannuum_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
480 cannuum_eg_homolog_subtype Last common ancestor with Capsicum annuum homologs
481 cannuum_eg_homolog_orthology_type Capsicum annuum homology type homologs
482 cannuum_eg_homolog_perc_id %id. target Capsicum annuum gene identical to query gene homologs
483 cannuum_eg_homolog_perc_id_r1 %id. query gene identical to target Capsicum annuum gene homologs
484 cannuum_eg_homolog_wga_coverage Capsicum annuum Whole-genome alignment coverage homologs
485 cannuum_eg_homolog_orthology_confidence Capsicum annuum orthology confidence [0 low, 1 high] homologs
486 cbraunii_eg_homolog_ensembl_gene Chara braunii gene stable ID homologs
487 cbraunii_eg_homolog_associated_gene_name Chara braunii gene name homologs
488 cbraunii_eg_homolog_ensembl_peptide Chara braunii protein or transcript stable ID homologs
489 cbraunii_eg_homolog_chromosome Chara braunii chromosome/scaffold name homologs
490 cbraunii_eg_homolog_chrom_start Chara braunii chromosome/scaffold start (bp) homologs
491 cbraunii_eg_homolog_chrom_end Chara braunii chromosome/scaffold end (bp) homologs
492 cbraunii_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
493 cbraunii_eg_homolog_subtype Last common ancestor with Chara braunii homologs
494 cbraunii_eg_homolog_orthology_type Chara braunii homology type homologs
495 cbraunii_eg_homolog_perc_id %id. target Chara braunii gene identical to query gene homologs
496 cbraunii_eg_homolog_perc_id_r1 %id. query gene identical to target Chara braunii gene homologs
497 cbraunii_eg_homolog_orthology_confidence Chara braunii orthology confidence [0 low, 1 high] homologs
498 cquinoa_eg_homolog_ensembl_gene Chenopodium quinoa gene stable ID homologs
499 cquinoa_eg_homolog_associated_gene_name Chenopodium quinoa gene name homologs
500 cquinoa_eg_homolog_ensembl_peptide Chenopodium quinoa protein or transcript stable ID homologs
501 cquinoa_eg_homolog_chromosome Chenopodium quinoa chromosome/scaffold name homologs
502 cquinoa_eg_homolog_chrom_start Chenopodium quinoa chromosome/scaffold start (bp) homologs
503 cquinoa_eg_homolog_chrom_end Chenopodium quinoa chromosome/scaffold end (bp) homologs
504 cquinoa_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
505 cquinoa_eg_homolog_subtype Last common ancestor with Chenopodium quinoa homologs
506 cquinoa_eg_homolog_orthology_type Chenopodium quinoa homology type homologs
507 cquinoa_eg_homolog_perc_id %id. target Chenopodium quinoa gene identical to query gene homologs
508 cquinoa_eg_homolog_perc_id_r1 %id. query gene identical to target Chenopodium quinoa gene homologs
509 cquinoa_eg_homolog_wga_coverage Chenopodium quinoa Whole-genome alignment coverage homologs
510 cquinoa_eg_homolog_orthology_confidence Chenopodium quinoa orthology confidence [0 low, 1 high] homologs
511 creinhardtii_eg_homolog_ensembl_gene Chlamydomonas reinhardtii gene stable ID homologs
512 creinhardtii_eg_homolog_associated_gene_name Chlamydomonas reinhardtii gene name homologs
513 creinhardtii_eg_homolog_ensembl_peptide Chlamydomonas reinhardtii protein or transcript stable ID homologs
514 creinhardtii_eg_homolog_chromosome Chlamydomonas reinhardtii chromosome/scaffold name homologs
515 creinhardtii_eg_homolog_chrom_start Chlamydomonas reinhardtii chromosome/scaffold start (bp) homologs
516 creinhardtii_eg_homolog_chrom_end Chlamydomonas reinhardtii chromosome/scaffold end (bp) homologs
517 creinhardtii_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
518 creinhardtii_eg_homolog_subtype Last common ancestor with Chlamydomonas reinhardtii homologs
519 creinhardtii_eg_homolog_orthology_type Chlamydomonas reinhardtii homology type homologs
520 creinhardtii_eg_homolog_perc_id %id. target Chlamydomonas reinhardtii gene identical to query gene homologs
521 creinhardtii_eg_homolog_perc_id_r1 %id. query gene identical to target Chlamydomonas reinhardtii gene homologs
522 creinhardtii_eg_homolog_wga_coverage Chlamydomonas reinhardtii Whole-genome alignment coverage homologs
523 creinhardtii_eg_homolog_orthology_confidence Chlamydomonas reinhardtii orthology confidence [0 low, 1 high] homologs
524 ccrispus_eg_homolog_ensembl_gene Chondrus crispus gene stable ID homologs
525 ccrispus_eg_homolog_associated_gene_name Chondrus crispus gene name homologs
526 ccrispus_eg_homolog_ensembl_peptide Chondrus crispus protein or transcript stable ID homologs
527 ccrispus_eg_homolog_chromosome Chondrus crispus chromosome/scaffold name homologs
528 ccrispus_eg_homolog_chrom_start Chondrus crispus chromosome/scaffold start (bp) homologs
529 ccrispus_eg_homolog_chrom_end Chondrus crispus chromosome/scaffold end (bp) homologs
530 ccrispus_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
531 ccrispus_eg_homolog_subtype Last common ancestor with Chondrus crispus homologs
532 ccrispus_eg_homolog_orthology_type Chondrus crispus homology type homologs
533 ccrispus_eg_homolog_perc_id %id. target Chondrus crispus gene identical to query gene homologs
534 ccrispus_eg_homolog_perc_id_r1 %id. query gene identical to target Chondrus crispus gene homologs
535 ccrispus_eg_homolog_wga_coverage Chondrus crispus Whole-genome alignment coverage homologs
536 ccrispus_eg_homolog_orthology_confidence Chondrus crispus orthology confidence [0 low, 1 high] homologs
537 clanatus_eg_homolog_ensembl_gene Citrullus lanatus gene stable ID homologs
538 clanatus_eg_homolog_associated_gene_name Citrullus lanatus gene name homologs
539 clanatus_eg_homolog_ensembl_peptide Citrullus lanatus protein or transcript stable ID homologs
540 clanatus_eg_homolog_chromosome Citrullus lanatus chromosome/scaffold name homologs
541 clanatus_eg_homolog_chrom_start Citrullus lanatus chromosome/scaffold start (bp) homologs
542 clanatus_eg_homolog_chrom_end Citrullus lanatus chromosome/scaffold end (bp) homologs
543 clanatus_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
544 clanatus_eg_homolog_subtype Last common ancestor with Citrullus lanatus homologs
545 clanatus_eg_homolog_orthology_type Citrullus lanatus homology type homologs
546 clanatus_eg_homolog_perc_id %id. target Citrullus lanatus gene identical to query gene homologs
547 clanatus_eg_homolog_perc_id_r1 %id. query gene identical to target Citrullus lanatus gene homologs
548 clanatus_eg_homolog_wga_coverage Citrullus lanatus Whole-genome alignment coverage homologs
549 clanatus_eg_homolog_orthology_confidence Citrullus lanatus orthology confidence [0 low, 1 high] homologs
550 cclementina_eg_homolog_ensembl_gene Citrus clementina gene stable ID homologs
551 cclementina_eg_homolog_associated_gene_name Citrus clementina gene name homologs
552 cclementina_eg_homolog_ensembl_peptide Citrus clementina protein or transcript stable ID homologs
553 cclementina_eg_homolog_chromosome Citrus clementina chromosome/scaffold name homologs
554 cclementina_eg_homolog_chrom_start Citrus clementina chromosome/scaffold start (bp) homologs
555 cclementina_eg_homolog_chrom_end Citrus clementina chromosome/scaffold end (bp) homologs
556 cclementina_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
557 cclementina_eg_homolog_subtype Last common ancestor with Citrus clementina homologs
558 cclementina_eg_homolog_orthology_type Citrus clementina homology type homologs
559 cclementina_eg_homolog_perc_id %id. target Citrus clementina gene identical to query gene homologs
560 cclementina_eg_homolog_perc_id_r1 %id. query gene identical to target Citrus clementina gene homologs
561 cclementina_eg_homolog_wga_coverage Citrus clementina Whole-genome alignment coverage homologs
562 cclementina_eg_homolog_orthology_confidence Citrus clementina orthology confidence [0 low, 1 high] homologs
563 ccanephora_eg_homolog_ensembl_gene Coffea canephora gene stable ID homologs
564 ccanephora_eg_homolog_associated_gene_name Coffea canephora gene name homologs
565 ccanephora_eg_homolog_ensembl_peptide Coffea canephora protein or transcript stable ID homologs
566 ccanephora_eg_homolog_chromosome Coffea canephora chromosome/scaffold name homologs
567 ccanephora_eg_homolog_chrom_start Coffea canephora chromosome/scaffold start (bp) homologs
568 ccanephora_eg_homolog_chrom_end Coffea canephora chromosome/scaffold end (bp) homologs
569 ccanephora_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
570 ccanephora_eg_homolog_subtype Last common ancestor with Coffea canephora homologs
571 ccanephora_eg_homolog_orthology_type Coffea canephora homology type homologs
572 ccanephora_eg_homolog_perc_id %id. target Coffea canephora gene identical to query gene homologs
573 ccanephora_eg_homolog_perc_id_r1 %id. query gene identical to target Coffea canephora gene homologs
574 ccanephora_eg_homolog_wga_coverage Coffea canephora Whole-genome alignment coverage homologs
575 ccanephora_eg_homolog_orthology_confidence Coffea canephora orthology confidence [0 low, 1 high] homologs
576 ccapsularis_eg_homolog_ensembl_gene Corchorus capsularis gene stable ID homologs
577 ccapsularis_eg_homolog_associated_gene_name Corchorus capsularis gene name homologs
578 ccapsularis_eg_homolog_ensembl_peptide Corchorus capsularis protein or transcript stable ID homologs
579 ccapsularis_eg_homolog_chromosome Corchorus capsularis chromosome/scaffold name homologs
580 ccapsularis_eg_homolog_chrom_start Corchorus capsularis chromosome/scaffold start (bp) homologs
581 ccapsularis_eg_homolog_chrom_end Corchorus capsularis chromosome/scaffold end (bp) homologs
582 ccapsularis_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
583 ccapsularis_eg_homolog_subtype Last common ancestor with Corchorus capsularis homologs
584 ccapsularis_eg_homolog_orthology_type Corchorus capsularis homology type homologs
585 ccapsularis_eg_homolog_perc_id %id. target Corchorus capsularis gene identical to query gene homologs
586 ccapsularis_eg_homolog_perc_id_r1 %id. query gene identical to target Corchorus capsularis gene homologs
587 ccapsularis_eg_homolog_wga_coverage Corchorus capsularis Whole-genome alignment coverage homologs
588 ccapsularis_eg_homolog_orthology_confidence Corchorus capsularis orthology confidence [0 low, 1 high] homologs
589 cavellana_eg_homolog_ensembl_gene Corylus avellana gene stable ID homologs
590 cavellana_eg_homolog_associated_gene_name Corylus avellana gene name homologs
591 cavellana_eg_homolog_ensembl_peptide Corylus avellana protein or transcript stable ID homologs
592 cavellana_eg_homolog_chromosome Corylus avellana chromosome/scaffold name homologs
593 cavellana_eg_homolog_chrom_start Corylus avellana chromosome/scaffold start (bp) homologs
594 cavellana_eg_homolog_chrom_end Corylus avellana chromosome/scaffold end (bp) homologs
595 cavellana_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
596 cavellana_eg_homolog_subtype Last common ancestor with Corylus avellana homologs
597 cavellana_eg_homolog_orthology_type Corylus avellana homology type homologs
598 cavellana_eg_homolog_perc_id %id. target Corylus avellana gene identical to query gene homologs
599 cavellana_eg_homolog_perc_id_r1 %id. query gene identical to target Corylus avellana gene homologs
600 cavellana_eg_homolog_orthology_confidence Corylus avellana orthology confidence [0 low, 1 high] homologs
601 ccitriodora_eg_homolog_ensembl_gene Corymbia citriodora gene stable ID homologs
602 ccitriodora_eg_homolog_associated_gene_name Corymbia citriodora gene name homologs
603 ccitriodora_eg_homolog_ensembl_peptide Corymbia citriodora protein or transcript stable ID homologs
604 ccitriodora_eg_homolog_chromosome Corymbia citriodora chromosome/scaffold name homologs
605 ccitriodora_eg_homolog_chrom_start Corymbia citriodora chromosome/scaffold start (bp) homologs
606 ccitriodora_eg_homolog_chrom_end Corymbia citriodora chromosome/scaffold end (bp) homologs
607 ccitriodora_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
608 ccitriodora_eg_homolog_subtype Last common ancestor with Corymbia citriodora homologs
609 ccitriodora_eg_homolog_orthology_type Corymbia citriodora homology type homologs
610 ccitriodora_eg_homolog_perc_id %id. target Corymbia citriodora gene identical to query gene homologs
611 ccitriodora_eg_homolog_perc_id_r1 %id. query gene identical to target Corymbia citriodora gene homologs
612 ccitriodora_eg_homolog_wga_coverage Corymbia citriodora Whole-genome alignment coverage homologs
613 ccitriodora_eg_homolog_orthology_confidence Corymbia citriodora orthology confidence [0 low, 1 high] homologs
614 cmelo_eg_homolog_ensembl_gene Cucumis melo gene stable ID homologs
615 cmelo_eg_homolog_associated_gene_name Cucumis melo gene name homologs
616 cmelo_eg_homolog_ensembl_peptide Cucumis melo protein or transcript stable ID homologs
617 cmelo_eg_homolog_chromosome Cucumis melo chromosome/scaffold name homologs
618 cmelo_eg_homolog_chrom_start Cucumis melo chromosome/scaffold start (bp) homologs
619 cmelo_eg_homolog_chrom_end Cucumis melo chromosome/scaffold end (bp) homologs
620 cmelo_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
621 cmelo_eg_homolog_subtype Last common ancestor with Cucumis melo homologs
622 cmelo_eg_homolog_orthology_type Cucumis melo homology type homologs
623 cmelo_eg_homolog_perc_id %id. target Cucumis melo gene identical to query gene homologs
624 cmelo_eg_homolog_perc_id_r1 %id. query gene identical to target Cucumis melo gene homologs
625 cmelo_eg_homolog_wga_coverage Cucumis melo Whole-genome alignment coverage homologs
626 cmelo_eg_homolog_orthology_confidence Cucumis melo orthology confidence [0 low, 1 high] homologs
627 csativus_eg_homolog_ensembl_gene Cucumis sativus gene stable ID homologs
628 csativus_eg_homolog_associated_gene_name Cucumis sativus gene name homologs
629 csativus_eg_homolog_ensembl_peptide Cucumis sativus protein or transcript stable ID homologs
630 csativus_eg_homolog_chromosome Cucumis sativus chromosome/scaffold name homologs
631 csativus_eg_homolog_chrom_start Cucumis sativus chromosome/scaffold start (bp) homologs
632 csativus_eg_homolog_chrom_end Cucumis sativus chromosome/scaffold end (bp) homologs
633 csativus_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
634 csativus_eg_homolog_subtype Last common ancestor with Cucumis sativus homologs
635 csativus_eg_homolog_orthology_type Cucumis sativus homology type homologs
636 csativus_eg_homolog_perc_id %id. target Cucumis sativus gene identical to query gene homologs
637 csativus_eg_homolog_perc_id_r1 %id. query gene identical to target Cucumis sativus gene homologs
638 csativus_eg_homolog_wga_coverage Cucumis sativus Whole-genome alignment coverage homologs
639 csativus_eg_homolog_orthology_confidence Cucumis sativus orthology confidence [0 low, 1 high] homologs
640 cmerolae_eg_homolog_ensembl_gene Cyanidioschyzon merolae gene stable ID homologs
641 cmerolae_eg_homolog_associated_gene_name Cyanidioschyzon merolae gene name homologs
642 cmerolae_eg_homolog_ensembl_peptide Cyanidioschyzon merolae protein or transcript stable ID homologs
643 cmerolae_eg_homolog_chromosome Cyanidioschyzon merolae chromosome/scaffold name homologs
644 cmerolae_eg_homolog_chrom_start Cyanidioschyzon merolae chromosome/scaffold start (bp) homologs
645 cmerolae_eg_homolog_chrom_end Cyanidioschyzon merolae chromosome/scaffold end (bp) homologs
646 cmerolae_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
647 cmerolae_eg_homolog_subtype Last common ancestor with Cyanidioschyzon merolae homologs
648 cmerolae_eg_homolog_orthology_type Cyanidioschyzon merolae homology type homologs
649 cmerolae_eg_homolog_perc_id %id. target Cyanidioschyzon merolae gene identical to query gene homologs
650 cmerolae_eg_homolog_perc_id_r1 %id. query gene identical to target Cyanidioschyzon merolae gene homologs
651 cmerolae_eg_homolog_wga_coverage Cyanidioschyzon merolae Whole-genome alignment coverage homologs
652 cmerolae_eg_homolog_orthology_confidence Cyanidioschyzon merolae orthology confidence [0 low, 1 high] homologs
653 ccardunculus_eg_homolog_ensembl_gene Cynara cardunculus gene stable ID homologs
654 ccardunculus_eg_homolog_associated_gene_name Cynara cardunculus gene name homologs
655 ccardunculus_eg_homolog_ensembl_peptide Cynara cardunculus protein or transcript stable ID homologs
656 ccardunculus_eg_homolog_chromosome Cynara cardunculus chromosome/scaffold name homologs
657 ccardunculus_eg_homolog_chrom_start Cynara cardunculus chromosome/scaffold start (bp) homologs
658 ccardunculus_eg_homolog_chrom_end Cynara cardunculus chromosome/scaffold end (bp) homologs
659 ccardunculus_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
660 ccardunculus_eg_homolog_subtype Last common ancestor with Cynara cardunculus homologs
661 ccardunculus_eg_homolog_orthology_type Cynara cardunculus homology type homologs
662 ccardunculus_eg_homolog_perc_id %id. target Cynara cardunculus gene identical to query gene homologs
663 ccardunculus_eg_homolog_perc_id_r1 %id. query gene identical to target Cynara cardunculus gene homologs
664 ccardunculus_eg_homolog_orthology_confidence Cynara cardunculus orthology confidence [0 low, 1 high] homologs
665 dcarota_eg_homolog_ensembl_gene Daucus carota gene stable ID homologs
666 dcarota_eg_homolog_associated_gene_name Daucus carota gene name homologs
667 dcarota_eg_homolog_ensembl_peptide Daucus carota protein or transcript stable ID homologs
668 dcarota_eg_homolog_chromosome Daucus carota chromosome/scaffold name homologs
669 dcarota_eg_homolog_chrom_start Daucus carota chromosome/scaffold start (bp) homologs
670 dcarota_eg_homolog_chrom_end Daucus carota chromosome/scaffold end (bp) homologs
671 dcarota_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
672 dcarota_eg_homolog_subtype Last common ancestor with Daucus carota homologs
673 dcarota_eg_homolog_orthology_type Daucus carota homology type homologs
674 dcarota_eg_homolog_perc_id %id. target Daucus carota gene identical to query gene homologs
675 dcarota_eg_homolog_perc_id_r1 %id. query gene identical to target Daucus carota gene homologs
676 dcarota_eg_homolog_wga_coverage Daucus carota Whole-genome alignment coverage homologs
677 dcarota_eg_homolog_orthology_confidence Daucus carota orthology confidence [0 low, 1 high] homologs
678 dexilis_eg_homolog_ensembl_gene Digitaria exilis gene stable ID homologs
679 dexilis_eg_homolog_associated_gene_name Digitaria exilis gene name homologs
680 dexilis_eg_homolog_ensembl_peptide Digitaria exilis protein or transcript stable ID homologs
681 dexilis_eg_homolog_chromosome Digitaria exilis chromosome/scaffold name homologs
682 dexilis_eg_homolog_chrom_start Digitaria exilis chromosome/scaffold start (bp) homologs
683 dexilis_eg_homolog_chrom_end Digitaria exilis chromosome/scaffold end (bp) homologs
684 dexilis_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
685 dexilis_eg_homolog_subtype Last common ancestor with Digitaria exilis homologs
686 dexilis_eg_homolog_orthology_type Digitaria exilis homology type homologs
687 dexilis_eg_homolog_perc_id %id. target Digitaria exilis gene identical to query gene homologs
688 dexilis_eg_homolog_perc_id_r1 %id. query gene identical to target Digitaria exilis gene homologs
689 dexilis_eg_homolog_orthology_confidence Digitaria exilis orthology confidence [0 low, 1 high] homologs
690 drotundata_eg_homolog_ensembl_gene Dioscorea rotundata gene stable ID homologs
691 drotundata_eg_homolog_associated_gene_name Dioscorea rotundata gene name homologs
692 drotundata_eg_homolog_ensembl_peptide Dioscorea rotundata protein or transcript stable ID homologs
693 drotundata_eg_homolog_chromosome Dioscorea rotundata chromosome/scaffold name homologs
694 drotundata_eg_homolog_chrom_start Dioscorea rotundata chromosome/scaffold start (bp) homologs
695 drotundata_eg_homolog_chrom_end Dioscorea rotundata chromosome/scaffold end (bp) homologs
696 drotundata_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
697 drotundata_eg_homolog_subtype Last common ancestor with Dioscorea rotundata homologs
698 drotundata_eg_homolog_orthology_type Dioscorea rotundata homology type homologs
699 drotundata_eg_homolog_perc_id %id. target Dioscorea rotundata gene identical to query gene homologs
700 drotundata_eg_homolog_perc_id_r1 %id. query gene identical to target Dioscorea rotundata gene homologs
701 drotundata_eg_homolog_orthology_confidence Dioscorea rotundata orthology confidence [0 low, 1 high] homologs
702 ecrusgalli_eg_homolog_ensembl_gene Echinochloa crus-galli gene stable ID homologs
703 ecrusgalli_eg_homolog_associated_gene_name Echinochloa crus-galli gene name homologs
704 ecrusgalli_eg_homolog_ensembl_peptide Echinochloa crus-galli protein or transcript stable ID homologs
705 ecrusgalli_eg_homolog_chromosome Echinochloa crus-galli chromosome/scaffold name homologs
706 ecrusgalli_eg_homolog_chrom_start Echinochloa crus-galli chromosome/scaffold start (bp) homologs
707 ecrusgalli_eg_homolog_chrom_end Echinochloa crus-galli chromosome/scaffold end (bp) homologs
708 ecrusgalli_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
709 ecrusgalli_eg_homolog_subtype Last common ancestor with Echinochloa crus-galli homologs
710 ecrusgalli_eg_homolog_orthology_type Echinochloa crus-galli homology type homologs
711 ecrusgalli_eg_homolog_perc_id %id. target Echinochloa crus-galli gene identical to query gene homologs
712 ecrusgalli_eg_homolog_perc_id_r1 %id. query gene identical to target Echinochloa crus-galli gene homologs
713 ecrusgalli_eg_homolog_orthology_confidence Echinochloa crus-galli orthology confidence [0 low, 1 high] homologs
714 ecurvula_eg_homolog_ensembl_gene Eragrostis curvula gene stable ID homologs
715 ecurvula_eg_homolog_associated_gene_name Eragrostis curvula gene name homologs
716 ecurvula_eg_homolog_ensembl_peptide Eragrostis curvula protein or transcript stable ID homologs
717 ecurvula_eg_homolog_chromosome Eragrostis curvula chromosome/scaffold name homologs
718 ecurvula_eg_homolog_chrom_start Eragrostis curvula chromosome/scaffold start (bp) homologs
719 ecurvula_eg_homolog_chrom_end Eragrostis curvula chromosome/scaffold end (bp) homologs
720 ecurvula_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
721 ecurvula_eg_homolog_subtype Last common ancestor with Eragrostis curvula homologs
722 ecurvula_eg_homolog_orthology_type Eragrostis curvula homology type homologs
723 ecurvula_eg_homolog_perc_id %id. target Eragrostis curvula gene identical to query gene homologs
724 ecurvula_eg_homolog_perc_id_r1 %id. query gene identical to target Eragrostis curvula gene homologs
725 ecurvula_eg_homolog_wga_coverage Eragrostis curvula Whole-genome alignment coverage homologs
726 ecurvula_eg_homolog_orthology_confidence Eragrostis curvula orthology confidence [0 low, 1 high] homologs
727 etef_eg_homolog_ensembl_gene Eragrostis tef gene stable ID homologs
728 etef_eg_homolog_associated_gene_name Eragrostis tef gene name homologs
729 etef_eg_homolog_ensembl_peptide Eragrostis tef protein or transcript stable ID homologs
730 etef_eg_homolog_chromosome Eragrostis tef chromosome/scaffold name homologs
731 etef_eg_homolog_chrom_start Eragrostis tef chromosome/scaffold start (bp) homologs
732 etef_eg_homolog_chrom_end Eragrostis tef chromosome/scaffold end (bp) homologs
733 etef_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
734 etef_eg_homolog_subtype Last common ancestor with Eragrostis tef homologs
735 etef_eg_homolog_orthology_type Eragrostis tef homology type homologs
736 etef_eg_homolog_perc_id %id. target Eragrostis tef gene identical to query gene homologs
737 etef_eg_homolog_perc_id_r1 %id. query gene identical to target Eragrostis tef gene homologs
738 etef_eg_homolog_orthology_confidence Eragrostis tef orthology confidence [0 low, 1 high] homologs
739 egrandis_eg_homolog_ensembl_gene Eucalyptus grandis gene stable ID homologs
740 egrandis_eg_homolog_associated_gene_name Eucalyptus grandis gene name homologs
741 egrandis_eg_homolog_ensembl_peptide Eucalyptus grandis protein or transcript stable ID homologs
742 egrandis_eg_homolog_chromosome Eucalyptus grandis chromosome/scaffold name homologs
743 egrandis_eg_homolog_chrom_start Eucalyptus grandis chromosome/scaffold start (bp) homologs
744 egrandis_eg_homolog_chrom_end Eucalyptus grandis chromosome/scaffold end (bp) homologs
745 egrandis_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
746 egrandis_eg_homolog_subtype Last common ancestor with Eucalyptus grandis homologs
747 egrandis_eg_homolog_orthology_type Eucalyptus grandis homology type homologs
748 egrandis_eg_homolog_perc_id %id. target Eucalyptus grandis gene identical to query gene homologs
749 egrandis_eg_homolog_perc_id_r1 %id. query gene identical to target Eucalyptus grandis gene homologs
750 egrandis_eg_homolog_wga_coverage Eucalyptus grandis Whole-genome alignment coverage homologs
751 egrandis_eg_homolog_orthology_confidence Eucalyptus grandis orthology confidence [0 low, 1 high] homologs
752 esalsugineum_eg_homolog_ensembl_gene Eutrema salsugineum gene stable ID homologs
753 esalsugineum_eg_homolog_associated_gene_name Eutrema salsugineum gene name homologs
754 esalsugineum_eg_homolog_ensembl_peptide Eutrema salsugineum protein or transcript stable ID homologs
755 esalsugineum_eg_homolog_chromosome Eutrema salsugineum chromosome/scaffold name homologs
756 esalsugineum_eg_homolog_chrom_start Eutrema salsugineum chromosome/scaffold start (bp) homologs
757 esalsugineum_eg_homolog_chrom_end Eutrema salsugineum chromosome/scaffold end (bp) homologs
758 esalsugineum_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
759 esalsugineum_eg_homolog_subtype Last common ancestor with Eutrema salsugineum homologs
760 esalsugineum_eg_homolog_orthology_type Eutrema salsugineum homology type homologs
761 esalsugineum_eg_homolog_perc_id %id. target Eutrema salsugineum gene identical to query gene homologs
762 esalsugineum_eg_homolog_perc_id_r1 %id. query gene identical to target Eutrema salsugineum gene homologs
763 esalsugineum_eg_homolog_goc_score Eutrema salsugineum Gene-order conservation score homologs
764 esalsugineum_eg_homolog_wga_coverage Eutrema salsugineum Whole-genome alignment coverage homologs
765 esalsugineum_eg_homolog_orthology_confidence Eutrema salsugineum orthology confidence [0 low, 1 high] homologs
766 fcarica_eg_homolog_ensembl_gene Ficus carica gene stable ID homologs
767 fcarica_eg_homolog_associated_gene_name Ficus carica gene name homologs
768 fcarica_eg_homolog_ensembl_peptide Ficus carica protein or transcript stable ID homologs
769 fcarica_eg_homolog_chromosome Ficus carica chromosome/scaffold name homologs
770 fcarica_eg_homolog_chrom_start Ficus carica chromosome/scaffold start (bp) homologs
771 fcarica_eg_homolog_chrom_end Ficus carica chromosome/scaffold end (bp) homologs
772 fcarica_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
773 fcarica_eg_homolog_subtype Last common ancestor with Ficus carica homologs
774 fcarica_eg_homolog_orthology_type Ficus carica homology type homologs
775 fcarica_eg_homolog_perc_id %id. target Ficus carica gene identical to query gene homologs
776 fcarica_eg_homolog_perc_id_r1 %id. query gene identical to target Ficus carica gene homologs
777 fcarica_eg_homolog_orthology_confidence Ficus carica orthology confidence [0 low, 1 high] homologs
778 fexcelsior_eg_homolog_ensembl_gene Fraxinus excelsior gene stable ID homologs
779 fexcelsior_eg_homolog_associated_gene_name Fraxinus excelsior gene name homologs
780 fexcelsior_eg_homolog_ensembl_peptide Fraxinus excelsior protein or transcript stable ID homologs
781 fexcelsior_eg_homolog_chromosome Fraxinus excelsior chromosome/scaffold name homologs
782 fexcelsior_eg_homolog_chrom_start Fraxinus excelsior chromosome/scaffold start (bp) homologs
783 fexcelsior_eg_homolog_chrom_end Fraxinus excelsior chromosome/scaffold end (bp) homologs
784 fexcelsior_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
785 fexcelsior_eg_homolog_subtype Last common ancestor with Fraxinus excelsior homologs
786 fexcelsior_eg_homolog_orthology_type Fraxinus excelsior homology type homologs
787 fexcelsior_eg_homolog_perc_id %id. target Fraxinus excelsior gene identical to query gene homologs
788 fexcelsior_eg_homolog_perc_id_r1 %id. query gene identical to target Fraxinus excelsior gene homologs
789 fexcelsior_eg_homolog_orthology_confidence Fraxinus excelsior orthology confidence [0 low, 1 high] homologs
790 gsulphuraria_eg_homolog_ensembl_gene Galdieria sulphuraria gene stable ID homologs
791 gsulphuraria_eg_homolog_associated_gene_name Galdieria sulphuraria gene name homologs
792 gsulphuraria_eg_homolog_ensembl_peptide Galdieria sulphuraria protein or transcript stable ID homologs
793 gsulphuraria_eg_homolog_chromosome Galdieria sulphuraria chromosome/scaffold name homologs
794 gsulphuraria_eg_homolog_chrom_start Galdieria sulphuraria chromosome/scaffold start (bp) homologs
795 gsulphuraria_eg_homolog_chrom_end Galdieria sulphuraria chromosome/scaffold end (bp) homologs
796 gsulphuraria_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
797 gsulphuraria_eg_homolog_subtype Last common ancestor with Galdieria sulphuraria homologs
798 gsulphuraria_eg_homolog_orthology_type Galdieria sulphuraria homology type homologs
799 gsulphuraria_eg_homolog_perc_id %id. target Galdieria sulphuraria gene identical to query gene homologs
800 gsulphuraria_eg_homolog_perc_id_r1 %id. query gene identical to target Galdieria sulphuraria gene homologs
801 gsulphuraria_eg_homolog_wga_coverage Galdieria sulphuraria Whole-genome alignment coverage homologs
802 gsulphuraria_eg_homolog_orthology_confidence Galdieria sulphuraria orthology confidence [0 low, 1 high] homologs
803 gmax_eg_homolog_ensembl_gene Glycine max gene stable ID homologs
804 gmax_eg_homolog_associated_gene_name Glycine max gene name homologs
805 gmax_eg_homolog_ensembl_peptide Glycine max protein or transcript stable ID homologs
806 gmax_eg_homolog_chromosome Glycine max chromosome/scaffold name homologs
807 gmax_eg_homolog_chrom_start Glycine max chromosome/scaffold start (bp) homologs
808 gmax_eg_homolog_chrom_end Glycine max chromosome/scaffold end (bp) homologs
809 gmax_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
810 gmax_eg_homolog_subtype Last common ancestor with Glycine max homologs
811 gmax_eg_homolog_orthology_type Glycine max homology type homologs
812 gmax_eg_homolog_perc_id %id. target Glycine max gene identical to query gene homologs
813 gmax_eg_homolog_perc_id_r1 %id. query gene identical to target Glycine max gene homologs
814 gmax_eg_homolog_wga_coverage Glycine max Whole-genome alignment coverage homologs
815 gmax_eg_homolog_orthology_confidence Glycine max orthology confidence [0 low, 1 high] homologs
816 gsoja_eg_homolog_ensembl_gene Glycine soja (Wild soybean) gene stable ID homologs
817 gsoja_eg_homolog_associated_gene_name Glycine soja (Wild soybean) gene name homologs
818 gsoja_eg_homolog_ensembl_peptide Glycine soja (Wild soybean) protein or transcript stable ID homologs
819 gsoja_eg_homolog_chromosome Glycine soja (Wild soybean) chromosome/scaffold name homologs
820 gsoja_eg_homolog_chrom_start Glycine soja (Wild soybean) chromosome/scaffold start (bp) homologs
821 gsoja_eg_homolog_chrom_end Glycine soja (Wild soybean) chromosome/scaffold end (bp) homologs
822 gsoja_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
823 gsoja_eg_homolog_subtype Last common ancestor with Glycine soja (Wild soybean) homologs
824 gsoja_eg_homolog_orthology_type Glycine soja (Wild soybean) homology type homologs
825 gsoja_eg_homolog_perc_id %id. target Glycine soja (Wild soybean) gene identical to query gene homologs
826 gsoja_eg_homolog_perc_id_r1 %id. query gene identical to target Glycine soja (Wild soybean) gene homologs
827 gsoja_eg_homolog_orthology_confidence Glycine soja (Wild soybean) orthology confidence [0 low, 1 high] homologs
828 graimondii_eg_homolog_ensembl_gene Gossypium raimondii gene stable ID homologs
829 graimondii_eg_homolog_associated_gene_name Gossypium raimondii gene name homologs
830 graimondii_eg_homolog_ensembl_peptide Gossypium raimondii protein or transcript stable ID homologs
831 graimondii_eg_homolog_chromosome Gossypium raimondii chromosome/scaffold name homologs
832 graimondii_eg_homolog_chrom_start Gossypium raimondii chromosome/scaffold start (bp) homologs
833 graimondii_eg_homolog_chrom_end Gossypium raimondii chromosome/scaffold end (bp) homologs
834 graimondii_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
835 graimondii_eg_homolog_subtype Last common ancestor with Gossypium raimondii homologs
836 graimondii_eg_homolog_orthology_type Gossypium raimondii homology type homologs
837 graimondii_eg_homolog_perc_id %id. target Gossypium raimondii gene identical to query gene homologs
838 graimondii_eg_homolog_perc_id_r1 %id. query gene identical to target Gossypium raimondii gene homologs
839 graimondii_eg_homolog_wga_coverage Gossypium raimondii Whole-genome alignment coverage homologs
840 graimondii_eg_homolog_orthology_confidence Gossypium raimondii orthology confidence [0 low, 1 high] homologs
841 hannuus_eg_homolog_ensembl_gene Helianthus annuus gene stable ID homologs
842 hannuus_eg_homolog_associated_gene_name Helianthus annuus gene name homologs
843 hannuus_eg_homolog_ensembl_peptide Helianthus annuus protein or transcript stable ID homologs
844 hannuus_eg_homolog_chromosome Helianthus annuus chromosome/scaffold name homologs
845 hannuus_eg_homolog_chrom_start Helianthus annuus chromosome/scaffold start (bp) homologs
846 hannuus_eg_homolog_chrom_end Helianthus annuus chromosome/scaffold end (bp) homologs
847 hannuus_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
848 hannuus_eg_homolog_subtype Last common ancestor with Helianthus annuus homologs
849 hannuus_eg_homolog_orthology_type Helianthus annuus homology type homologs
850 hannuus_eg_homolog_perc_id %id. target Helianthus annuus gene identical to query gene homologs
851 hannuus_eg_homolog_perc_id_r1 %id. query gene identical to target Helianthus annuus gene homologs
852 hannuus_eg_homolog_orthology_confidence Helianthus annuus orthology confidence [0 low, 1 high] homologs
853 hvulgare_eg_homolog_ensembl_gene Hordeum vulgare gene stable ID homologs
854 hvulgare_eg_homolog_associated_gene_name Hordeum vulgare gene name homologs
855 hvulgare_eg_homolog_ensembl_peptide Hordeum vulgare protein or transcript stable ID homologs
856 hvulgare_eg_homolog_chromosome Hordeum vulgare chromosome/scaffold name homologs
857 hvulgare_eg_homolog_chrom_start Hordeum vulgare chromosome/scaffold start (bp) homologs
858 hvulgare_eg_homolog_chrom_end Hordeum vulgare chromosome/scaffold end (bp) homologs
859 hvulgare_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
860 hvulgare_eg_homolog_subtype Last common ancestor with Hordeum vulgare homologs
861 hvulgare_eg_homolog_orthology_type Hordeum vulgare homology type homologs
862 hvulgare_eg_homolog_perc_id %id. target Hordeum vulgare gene identical to query gene homologs
863 hvulgare_eg_homolog_perc_id_r1 %id. query gene identical to target Hordeum vulgare gene homologs
864 hvulgare_eg_homolog_orthology_confidence Hordeum vulgare orthology confidence [0 low, 1 high] homologs
865 itriloba_eg_homolog_ensembl_gene Ipomoea triloba gene stable ID homologs
866 itriloba_eg_homolog_associated_gene_name Ipomoea triloba gene name homologs
867 itriloba_eg_homolog_ensembl_peptide Ipomoea triloba protein or transcript stable ID homologs
868 itriloba_eg_homolog_chromosome Ipomoea triloba chromosome/scaffold name homologs
869 itriloba_eg_homolog_chrom_start Ipomoea triloba chromosome/scaffold start (bp) homologs
870 itriloba_eg_homolog_chrom_end Ipomoea triloba chromosome/scaffold end (bp) homologs
871 itriloba_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
872 itriloba_eg_homolog_subtype Last common ancestor with Ipomoea triloba homologs
873 itriloba_eg_homolog_orthology_type Ipomoea triloba homology type homologs
874 itriloba_eg_homolog_perc_id %id. target Ipomoea triloba gene identical to query gene homologs
875 itriloba_eg_homolog_perc_id_r1 %id. query gene identical to target Ipomoea triloba gene homologs
876 itriloba_eg_homolog_wga_coverage Ipomoea triloba Whole-genome alignment coverage homologs
877 itriloba_eg_homolog_orthology_confidence Ipomoea triloba orthology confidence [0 low, 1 high] homologs
878 jregia_eg_homolog_ensembl_gene Juglans regia gene stable ID homologs
879 jregia_eg_homolog_associated_gene_name Juglans regia gene name homologs
880 jregia_eg_homolog_ensembl_peptide Juglans regia protein or transcript stable ID homologs
881 jregia_eg_homolog_chromosome Juglans regia chromosome/scaffold name homologs
882 jregia_eg_homolog_chrom_start Juglans regia chromosome/scaffold start (bp) homologs
883 jregia_eg_homolog_chrom_end Juglans regia chromosome/scaffold end (bp) homologs
884 jregia_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
885 jregia_eg_homolog_subtype Last common ancestor with Juglans regia homologs
886 jregia_eg_homolog_orthology_type Juglans regia homology type homologs
887 jregia_eg_homolog_perc_id %id. target Juglans regia gene identical to query gene homologs
888 jregia_eg_homolog_perc_id_r1 %id. query gene identical to target Juglans regia gene homologs
889 jregia_eg_homolog_orthology_confidence Juglans regia orthology confidence [0 low, 1 high] homologs
890 kfedtschenkoi_eg_homolog_ensembl_gene Kalanchoe fedtschenkoi gene stable ID homologs
891 kfedtschenkoi_eg_homolog_associated_gene_name Kalanchoe fedtschenkoi gene name homologs
892 kfedtschenkoi_eg_homolog_ensembl_peptide Kalanchoe fedtschenkoi protein or transcript stable ID homologs
893 kfedtschenkoi_eg_homolog_chromosome Kalanchoe fedtschenkoi chromosome/scaffold name homologs
894 kfedtschenkoi_eg_homolog_chrom_start Kalanchoe fedtschenkoi chromosome/scaffold start (bp) homologs
895 kfedtschenkoi_eg_homolog_chrom_end Kalanchoe fedtschenkoi chromosome/scaffold end (bp) homologs
896 kfedtschenkoi_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
897 kfedtschenkoi_eg_homolog_subtype Last common ancestor with Kalanchoe fedtschenkoi homologs
898 kfedtschenkoi_eg_homolog_orthology_type Kalanchoe fedtschenkoi homology type homologs
899 kfedtschenkoi_eg_homolog_perc_id %id. target Kalanchoe fedtschenkoi gene identical to query gene homologs
900 kfedtschenkoi_eg_homolog_perc_id_r1 %id. query gene identical to target Kalanchoe fedtschenkoi gene homologs
901 kfedtschenkoi_eg_homolog_wga_coverage Kalanchoe fedtschenkoi Whole-genome alignment coverage homologs
902 kfedtschenkoi_eg_homolog_orthology_confidence Kalanchoe fedtschenkoi orthology confidence [0 low, 1 high] homologs
903 lpgca030347555v1cm_eg_homolog_ensembl_gene Lablab purpureus Natoba gene stable ID homologs
904 lpgca030347555v1cm_eg_homolog_associated_gene_name Lablab purpureus Natoba gene name homologs
905 lpgca030347555v1cm_eg_homolog_ensembl_peptide Lablab purpureus Natoba protein or transcript stable ID homologs
906 lpgca030347555v1cm_eg_homolog_chromosome Lablab purpureus Natoba chromosome/scaffold name homologs
907 lpgca030347555v1cm_eg_homolog_chrom_start Lablab purpureus Natoba chromosome/scaffold start (bp) homologs
908 lpgca030347555v1cm_eg_homolog_chrom_end Lablab purpureus Natoba chromosome/scaffold end (bp) homologs
909 lpgca030347555v1cm_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
910 lpgca030347555v1cm_eg_homolog_subtype Last common ancestor with Lablab purpureus Natoba homologs
911 lpgca030347555v1cm_eg_homolog_orthology_type Lablab purpureus Natoba homology type homologs
912 lpgca030347555v1cm_eg_homolog_perc_id %id. target Lablab purpureus Natoba gene identical to query gene homologs
913 lpgca030347555v1cm_eg_homolog_perc_id_r1 %id. query gene identical to target Lablab purpureus Natoba gene homologs
914 lpgca030347555v1cm_eg_homolog_orthology_confidence Lablab purpureus Natoba orthology confidence [0 low, 1 high] homologs
915 lsativa_eg_homolog_ensembl_gene Lactuca sativa gene stable ID homologs
916 lsativa_eg_homolog_associated_gene_name Lactuca sativa gene name homologs
917 lsativa_eg_homolog_ensembl_peptide Lactuca sativa protein or transcript stable ID homologs
918 lsativa_eg_homolog_chromosome Lactuca sativa chromosome/scaffold name homologs
919 lsativa_eg_homolog_chrom_start Lactuca sativa chromosome/scaffold start (bp) homologs
920 lsativa_eg_homolog_chrom_end Lactuca sativa chromosome/scaffold end (bp) homologs
921 lsativa_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
922 lsativa_eg_homolog_subtype Last common ancestor with Lactuca sativa homologs
923 lsativa_eg_homolog_orthology_type Lactuca sativa homology type homologs
924 lsativa_eg_homolog_perc_id %id. target Lactuca sativa gene identical to query gene homologs
925 lsativa_eg_homolog_perc_id_r1 %id. query gene identical to target Lactuca sativa gene homologs
926 lsativa_eg_homolog_orthology_confidence Lactuca sativa orthology confidence [0 low, 1 high] homologs
927 lsativus_eg_homolog_ensembl_gene Lathyrus sativus gene stable ID homologs
928 lsativus_eg_homolog_associated_gene_name Lathyrus sativus gene name homologs
929 lsativus_eg_homolog_ensembl_peptide Lathyrus sativus protein or transcript stable ID homologs
930 lsativus_eg_homolog_chromosome Lathyrus sativus chromosome/scaffold name homologs
931 lsativus_eg_homolog_chrom_start Lathyrus sativus chromosome/scaffold start (bp) homologs
932 lsativus_eg_homolog_chrom_end Lathyrus sativus chromosome/scaffold end (bp) homologs
933 lsativus_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
934 lsativus_eg_homolog_subtype Last common ancestor with Lathyrus sativus homologs
935 lsativus_eg_homolog_orthology_type Lathyrus sativus homology type homologs
936 lsativus_eg_homolog_perc_id %id. target Lathyrus sativus gene identical to query gene homologs
937 lsativus_eg_homolog_perc_id_r1 %id. query gene identical to target Lathyrus sativus gene homologs
938 lsativus_eg_homolog_orthology_confidence Lathyrus sativus orthology confidence [0 low, 1 high] homologs
939 lperrieri_eg_homolog_ensembl_gene Leersia perrieri gene stable ID homologs
940 lperrieri_eg_homolog_associated_gene_name Leersia perrieri gene name homologs
941 lperrieri_eg_homolog_ensembl_peptide Leersia perrieri protein or transcript stable ID homologs
942 lperrieri_eg_homolog_chromosome Leersia perrieri chromosome/scaffold name homologs
943 lperrieri_eg_homolog_chrom_start Leersia perrieri chromosome/scaffold start (bp) homologs
944 lperrieri_eg_homolog_chrom_end Leersia perrieri chromosome/scaffold end (bp) homologs
945 lperrieri_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
946 lperrieri_eg_homolog_subtype Last common ancestor with Leersia perrieri homologs
947 lperrieri_eg_homolog_orthology_type Leersia perrieri homology type homologs
948 lperrieri_eg_homolog_perc_id %id. target Leersia perrieri gene identical to query gene homologs
949 lperrieri_eg_homolog_perc_id_r1 %id. query gene identical to target Leersia perrieri gene homologs
950 lperrieri_eg_homolog_wga_coverage Leersia perrieri Whole-genome alignment coverage homologs
951 lperrieri_eg_homolog_orthology_confidence Leersia perrieri orthology confidence [0 low, 1 high] homologs
952 lperenne_eg_homolog_ensembl_gene Lolium perenne gene stable ID homologs
953 lperenne_eg_homolog_associated_gene_name Lolium perenne gene name homologs
954 lperenne_eg_homolog_ensembl_peptide Lolium perenne protein or transcript stable ID homologs
955 lperenne_eg_homolog_chromosome Lolium perenne chromosome/scaffold name homologs
956 lperenne_eg_homolog_chrom_start Lolium perenne chromosome/scaffold start (bp) homologs
957 lperenne_eg_homolog_chrom_end Lolium perenne chromosome/scaffold end (bp) homologs
958 lperenne_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
959 lperenne_eg_homolog_subtype Last common ancestor with Lolium perenne homologs
960 lperenne_eg_homolog_orthology_type Lolium perenne homology type homologs
961 lperenne_eg_homolog_perc_id %id. target Lolium perenne gene identical to query gene homologs
962 lperenne_eg_homolog_perc_id_r1 %id. query gene identical to target Lolium perenne gene homologs
963 lperenne_eg_homolog_orthology_confidence Lolium perenne orthology confidence [0 low, 1 high] homologs
964 langustifolius_eg_homolog_ensembl_gene Lupinus angustifolius gene stable ID homologs
965 langustifolius_eg_homolog_associated_gene_name Lupinus angustifolius gene name homologs
966 langustifolius_eg_homolog_ensembl_peptide Lupinus angustifolius protein or transcript stable ID homologs
967 langustifolius_eg_homolog_chromosome Lupinus angustifolius chromosome/scaffold name homologs
968 langustifolius_eg_homolog_chrom_start Lupinus angustifolius chromosome/scaffold start (bp) homologs
969 langustifolius_eg_homolog_chrom_end Lupinus angustifolius chromosome/scaffold end (bp) homologs
970 langustifolius_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
971 langustifolius_eg_homolog_subtype Last common ancestor with Lupinus angustifolius homologs
972 langustifolius_eg_homolog_orthology_type Lupinus angustifolius homology type homologs
973 langustifolius_eg_homolog_perc_id %id. target Lupinus angustifolius gene identical to query gene homologs
974 langustifolius_eg_homolog_perc_id_r1 %id. query gene identical to target Lupinus angustifolius gene homologs
975 langustifolius_eg_homolog_wga_coverage Lupinus angustifolius Whole-genome alignment coverage homologs
976 langustifolius_eg_homolog_orthology_confidence Lupinus angustifolius orthology confidence [0 low, 1 high] homologs
977 mdgolden_eg_homolog_ensembl_gene Malus domestica Golden gene stable ID homologs
978 mdgolden_eg_homolog_associated_gene_name Malus domestica Golden gene name homologs
979 mdgolden_eg_homolog_ensembl_peptide Malus domestica Golden protein or transcript stable ID homologs
980 mdgolden_eg_homolog_chromosome Malus domestica Golden chromosome/scaffold name homologs
981 mdgolden_eg_homolog_chrom_start Malus domestica Golden chromosome/scaffold start (bp) homologs
982 mdgolden_eg_homolog_chrom_end Malus domestica Golden chromosome/scaffold end (bp) homologs
983 mdgolden_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
984 mdgolden_eg_homolog_subtype Last common ancestor with Malus domestica Golden homologs
985 mdgolden_eg_homolog_orthology_type Malus domestica Golden homology type homologs
986 mdgolden_eg_homolog_perc_id %id. target Malus domestica Golden gene identical to query gene homologs
987 mdgolden_eg_homolog_perc_id_r1 %id. query gene identical to target Malus domestica Golden gene homologs
988 mdgolden_eg_homolog_wga_coverage Malus domestica Golden Whole-genome alignment coverage homologs
989 mdgolden_eg_homolog_orthology_confidence Malus domestica Golden orthology confidence [0 low, 1 high] homologs
990 mesculenta_eg_homolog_ensembl_gene Manihot esculenta gene stable ID homologs
991 mesculenta_eg_homolog_associated_gene_name Manihot esculenta gene name homologs
992 mesculenta_eg_homolog_ensembl_peptide Manihot esculenta protein or transcript stable ID homologs
993 mesculenta_eg_homolog_chromosome Manihot esculenta chromosome/scaffold name homologs
994 mesculenta_eg_homolog_chrom_start Manihot esculenta chromosome/scaffold start (bp) homologs
995 mesculenta_eg_homolog_chrom_end Manihot esculenta chromosome/scaffold end (bp) homologs
996 mesculenta_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
997 mesculenta_eg_homolog_subtype Last common ancestor with Manihot esculenta homologs
998 mesculenta_eg_homolog_orthology_type Manihot esculenta homology type homologs
999 mesculenta_eg_homolog_perc_id %id. target Manihot esculenta gene identical to query gene homologs
1000 mesculenta_eg_homolog_perc_id_r1 %id. query gene identical to target Manihot esculenta gene homologs
1001 mesculenta_eg_homolog_orthology_confidence Manihot esculenta orthology confidence [0 low, 1 high] homologs
1002 mpolymorpha_eg_homolog_ensembl_gene Marchantia polymorpha gene stable ID homologs
1003 mpolymorpha_eg_homolog_associated_gene_name Marchantia polymorpha gene name homologs
1004 mpolymorpha_eg_homolog_ensembl_peptide Marchantia polymorpha protein or transcript stable ID homologs
1005 mpolymorpha_eg_homolog_chromosome Marchantia polymorpha chromosome/scaffold name homologs
1006 mpolymorpha_eg_homolog_chrom_start Marchantia polymorpha chromosome/scaffold start (bp) homologs
1007 mpolymorpha_eg_homolog_chrom_end Marchantia polymorpha chromosome/scaffold end (bp) homologs
1008 mpolymorpha_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1009 mpolymorpha_eg_homolog_subtype Last common ancestor with Marchantia polymorpha homologs
1010 mpolymorpha_eg_homolog_orthology_type Marchantia polymorpha homology type homologs
1011 mpolymorpha_eg_homolog_perc_id %id. target Marchantia polymorpha gene identical to query gene homologs
1012 mpolymorpha_eg_homolog_perc_id_r1 %id. query gene identical to target Marchantia polymorpha gene homologs
1013 mpolymorpha_eg_homolog_wga_coverage Marchantia polymorpha Whole-genome alignment coverage homologs
1014 mpolymorpha_eg_homolog_orthology_confidence Marchantia polymorpha orthology confidence [0 low, 1 high] homologs
1015 mtruncatula_eg_homolog_ensembl_gene Medicago truncatula gene stable ID homologs
1016 mtruncatula_eg_homolog_associated_gene_name Medicago truncatula gene name homologs
1017 mtruncatula_eg_homolog_ensembl_peptide Medicago truncatula protein or transcript stable ID homologs
1018 mtruncatula_eg_homolog_chromosome Medicago truncatula chromosome/scaffold name homologs
1019 mtruncatula_eg_homolog_chrom_start Medicago truncatula chromosome/scaffold start (bp) homologs
1020 mtruncatula_eg_homolog_chrom_end Medicago truncatula chromosome/scaffold end (bp) homologs
1021 mtruncatula_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1022 mtruncatula_eg_homolog_subtype Last common ancestor with Medicago truncatula homologs
1023 mtruncatula_eg_homolog_orthology_type Medicago truncatula homology type homologs
1024 mtruncatula_eg_homolog_perc_id %id. target Medicago truncatula gene identical to query gene homologs
1025 mtruncatula_eg_homolog_perc_id_r1 %id. query gene identical to target Medicago truncatula gene homologs
1026 mtruncatula_eg_homolog_orthology_confidence Medicago truncatula orthology confidence [0 low, 1 high] homologs
1027 macuminata_eg_homolog_ensembl_gene Musa acuminata gene stable ID homologs
1028 macuminata_eg_homolog_associated_gene_name Musa acuminata gene name homologs
1029 macuminata_eg_homolog_ensembl_peptide Musa acuminata protein or transcript stable ID homologs
1030 macuminata_eg_homolog_chromosome Musa acuminata chromosome/scaffold name homologs
1031 macuminata_eg_homolog_chrom_start Musa acuminata chromosome/scaffold start (bp) homologs
1032 macuminata_eg_homolog_chrom_end Musa acuminata chromosome/scaffold end (bp) homologs
1033 macuminata_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1034 macuminata_eg_homolog_subtype Last common ancestor with Musa acuminata homologs
1035 macuminata_eg_homolog_orthology_type Musa acuminata homology type homologs
1036 macuminata_eg_homolog_perc_id %id. target Musa acuminata gene identical to query gene homologs
1037 macuminata_eg_homolog_perc_id_r1 %id. query gene identical to target Musa acuminata gene homologs
1038 macuminata_eg_homolog_orthology_confidence Musa acuminata orthology confidence [0 low, 1 high] homologs
1039 nattenuata_eg_homolog_ensembl_gene Nicotiana attenuata gene stable ID homologs
1040 nattenuata_eg_homolog_associated_gene_name Nicotiana attenuata gene name homologs
1041 nattenuata_eg_homolog_ensembl_peptide Nicotiana attenuata protein or transcript stable ID homologs
1042 nattenuata_eg_homolog_chromosome Nicotiana attenuata chromosome/scaffold name homologs
1043 nattenuata_eg_homolog_chrom_start Nicotiana attenuata chromosome/scaffold start (bp) homologs
1044 nattenuata_eg_homolog_chrom_end Nicotiana attenuata chromosome/scaffold end (bp) homologs
1045 nattenuata_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1046 nattenuata_eg_homolog_subtype Last common ancestor with Nicotiana attenuata homologs
1047 nattenuata_eg_homolog_orthology_type Nicotiana attenuata homology type homologs
1048 nattenuata_eg_homolog_perc_id %id. target Nicotiana attenuata gene identical to query gene homologs
1049 nattenuata_eg_homolog_perc_id_r1 %id. query gene identical to target Nicotiana attenuata gene homologs
1050 nattenuata_eg_homolog_wga_coverage Nicotiana attenuata Whole-genome alignment coverage homologs
1051 nattenuata_eg_homolog_orthology_confidence Nicotiana attenuata orthology confidence [0 low, 1 high] homologs
1052 ncolorata_eg_homolog_ensembl_gene Nymphaea colorata gene stable ID homologs
1053 ncolorata_eg_homolog_associated_gene_name Nymphaea colorata gene name homologs
1054 ncolorata_eg_homolog_ensembl_peptide Nymphaea colorata protein or transcript stable ID homologs
1055 ncolorata_eg_homolog_chromosome Nymphaea colorata chromosome/scaffold name homologs
1056 ncolorata_eg_homolog_chrom_start Nymphaea colorata chromosome/scaffold start (bp) homologs
1057 ncolorata_eg_homolog_chrom_end Nymphaea colorata chromosome/scaffold end (bp) homologs
1058 ncolorata_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1059 ncolorata_eg_homolog_subtype Last common ancestor with Nymphaea colorata homologs
1060 ncolorata_eg_homolog_orthology_type Nymphaea colorata homology type homologs
1061 ncolorata_eg_homolog_perc_id %id. target Nymphaea colorata gene identical to query gene homologs
1062 ncolorata_eg_homolog_perc_id_r1 %id. query gene identical to target Nymphaea colorata gene homologs
1063 ncolorata_eg_homolog_wga_coverage Nymphaea colorata Whole-genome alignment coverage homologs
1064 ncolorata_eg_homolog_orthology_confidence Nymphaea colorata orthology confidence [0 low, 1 high] homologs
1065 oeuropaea_eg_homolog_ensembl_gene Olea europaea gene stable ID homologs
1066 oeuropaea_eg_homolog_associated_gene_name Olea europaea gene name homologs
1067 oeuropaea_eg_homolog_ensembl_peptide Olea europaea protein or transcript stable ID homologs
1068 oeuropaea_eg_homolog_chromosome Olea europaea chromosome/scaffold name homologs
1069 oeuropaea_eg_homolog_chrom_start Olea europaea chromosome/scaffold start (bp) homologs
1070 oeuropaea_eg_homolog_chrom_end Olea europaea chromosome/scaffold end (bp) homologs
1071 oeuropaea_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1072 oeuropaea_eg_homolog_subtype Last common ancestor with Olea europaea homologs
1073 oeuropaea_eg_homolog_orthology_type Olea europaea homology type homologs
1074 oeuropaea_eg_homolog_perc_id %id. target Olea europaea gene identical to query gene homologs
1075 oeuropaea_eg_homolog_perc_id_r1 %id. query gene identical to target Olea europaea gene homologs
1076 oeuropaea_eg_homolog_orthology_confidence Olea europaea orthology confidence [0 low, 1 high] homologs
1077 obarthii_eg_homolog_ensembl_gene Oryza barthii gene stable ID homologs
1078 obarthii_eg_homolog_associated_gene_name Oryza barthii gene name homologs
1079 obarthii_eg_homolog_ensembl_peptide Oryza barthii protein or transcript stable ID homologs
1080 obarthii_eg_homolog_chromosome Oryza barthii chromosome/scaffold name homologs
1081 obarthii_eg_homolog_chrom_start Oryza barthii chromosome/scaffold start (bp) homologs
1082 obarthii_eg_homolog_chrom_end Oryza barthii chromosome/scaffold end (bp) homologs
1083 obarthii_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1084 obarthii_eg_homolog_subtype Last common ancestor with Oryza barthii homologs
1085 obarthii_eg_homolog_orthology_type Oryza barthii homology type homologs
1086 obarthii_eg_homolog_perc_id %id. target Oryza barthii gene identical to query gene homologs
1087 obarthii_eg_homolog_perc_id_r1 %id. query gene identical to target Oryza barthii gene homologs
1088 obarthii_eg_homolog_wga_coverage Oryza barthii Whole-genome alignment coverage homologs
1089 obarthii_eg_homolog_orthology_confidence Oryza barthii orthology confidence [0 low, 1 high] homologs
1090 obrachyantha_eg_homolog_ensembl_gene Oryza brachyantha gene stable ID homologs
1091 obrachyantha_eg_homolog_associated_gene_name Oryza brachyantha gene name homologs
1092 obrachyantha_eg_homolog_ensembl_peptide Oryza brachyantha protein or transcript stable ID homologs
1093 obrachyantha_eg_homolog_chromosome Oryza brachyantha chromosome/scaffold name homologs
1094 obrachyantha_eg_homolog_chrom_start Oryza brachyantha chromosome/scaffold start (bp) homologs
1095 obrachyantha_eg_homolog_chrom_end Oryza brachyantha chromosome/scaffold end (bp) homologs
1096 obrachyantha_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1097 obrachyantha_eg_homolog_subtype Last common ancestor with Oryza brachyantha homologs
1098 obrachyantha_eg_homolog_orthology_type Oryza brachyantha homology type homologs
1099 obrachyantha_eg_homolog_perc_id %id. target Oryza brachyantha gene identical to query gene homologs
1100 obrachyantha_eg_homolog_perc_id_r1 %id. query gene identical to target Oryza brachyantha gene homologs
1101 obrachyantha_eg_homolog_wga_coverage Oryza brachyantha Whole-genome alignment coverage homologs
1102 obrachyantha_eg_homolog_orthology_confidence Oryza brachyantha orthology confidence [0 low, 1 high] homologs
1103 oglaberrima_eg_homolog_ensembl_gene Oryza glaberrima gene stable ID homologs
1104 oglaberrima_eg_homolog_associated_gene_name Oryza glaberrima gene name homologs
1105 oglaberrima_eg_homolog_ensembl_peptide Oryza glaberrima protein or transcript stable ID homologs
1106 oglaberrima_eg_homolog_chromosome Oryza glaberrima chromosome/scaffold name homologs
1107 oglaberrima_eg_homolog_chrom_start Oryza glaberrima chromosome/scaffold start (bp) homologs
1108 oglaberrima_eg_homolog_chrom_end Oryza glaberrima chromosome/scaffold end (bp) homologs
1109 oglaberrima_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1110 oglaberrima_eg_homolog_subtype Last common ancestor with Oryza glaberrima homologs
1111 oglaberrima_eg_homolog_orthology_type Oryza glaberrima homology type homologs
1112 oglaberrima_eg_homolog_perc_id %id. target Oryza glaberrima gene identical to query gene homologs
1113 oglaberrima_eg_homolog_perc_id_r1 %id. query gene identical to target Oryza glaberrima gene homologs
1114 oglaberrima_eg_homolog_wga_coverage Oryza glaberrima Whole-genome alignment coverage homologs
1115 oglaberrima_eg_homolog_orthology_confidence Oryza glaberrima orthology confidence [0 low, 1 high] homologs
1116 oglumipatula_eg_homolog_ensembl_gene Oryza glumipatula gene stable ID homologs
1117 oglumipatula_eg_homolog_associated_gene_name Oryza glumipatula gene name homologs
1118 oglumipatula_eg_homolog_ensembl_peptide Oryza glumipatula protein or transcript stable ID homologs
1119 oglumipatula_eg_homolog_chromosome Oryza glumipatula chromosome/scaffold name homologs
1120 oglumipatula_eg_homolog_chrom_start Oryza glumipatula chromosome/scaffold start (bp) homologs
1121 oglumipatula_eg_homolog_chrom_end Oryza glumipatula chromosome/scaffold end (bp) homologs
1122 oglumipatula_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1123 oglumipatula_eg_homolog_subtype Last common ancestor with Oryza glumipatula homologs
1124 oglumipatula_eg_homolog_orthology_type Oryza glumipatula homology type homologs
1125 oglumipatula_eg_homolog_perc_id %id. target Oryza glumipatula gene identical to query gene homologs
1126 oglumipatula_eg_homolog_perc_id_r1 %id. query gene identical to target Oryza glumipatula gene homologs
1127 oglumipatula_eg_homolog_wga_coverage Oryza glumipatula Whole-genome alignment coverage homologs
1128 oglumipatula_eg_homolog_orthology_confidence Oryza glumipatula orthology confidence [0 low, 1 high] homologs
1129 olongistaminata_eg_homolog_ensembl_gene Oryza longistaminata gene stable ID homologs
1130 olongistaminata_eg_homolog_associated_gene_name Oryza longistaminata gene name homologs
1131 olongistaminata_eg_homolog_ensembl_peptide Oryza longistaminata protein or transcript stable ID homologs
1132 olongistaminata_eg_homolog_chromosome Oryza longistaminata chromosome/scaffold name homologs
1133 olongistaminata_eg_homolog_chrom_start Oryza longistaminata chromosome/scaffold start (bp) homologs
1134 olongistaminata_eg_homolog_chrom_end Oryza longistaminata chromosome/scaffold end (bp) homologs
1135 olongistaminata_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1136 olongistaminata_eg_homolog_subtype Last common ancestor with Oryza longistaminata homologs
1137 olongistaminata_eg_homolog_orthology_type Oryza longistaminata homology type homologs
1138 olongistaminata_eg_homolog_perc_id %id. target Oryza longistaminata gene identical to query gene homologs
1139 olongistaminata_eg_homolog_perc_id_r1 %id. query gene identical to target Oryza longistaminata gene homologs
1140 olongistaminata_eg_homolog_wga_coverage Oryza longistaminata Whole-genome alignment coverage homologs
1141 olongistaminata_eg_homolog_orthology_confidence Oryza longistaminata orthology confidence [0 low, 1 high] homologs
1142 omeridionalis_eg_homolog_ensembl_gene Oryza meridionalis gene stable ID homologs
1143 omeridionalis_eg_homolog_associated_gene_name Oryza meridionalis gene name homologs
1144 omeridionalis_eg_homolog_ensembl_peptide Oryza meridionalis protein or transcript stable ID homologs
1145 omeridionalis_eg_homolog_chromosome Oryza meridionalis chromosome/scaffold name homologs
1146 omeridionalis_eg_homolog_chrom_start Oryza meridionalis chromosome/scaffold start (bp) homologs
1147 omeridionalis_eg_homolog_chrom_end Oryza meridionalis chromosome/scaffold end (bp) homologs
1148 omeridionalis_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1149 omeridionalis_eg_homolog_subtype Last common ancestor with Oryza meridionalis homologs
1150 omeridionalis_eg_homolog_orthology_type Oryza meridionalis homology type homologs
1151 omeridionalis_eg_homolog_perc_id %id. target Oryza meridionalis gene identical to query gene homologs
1152 omeridionalis_eg_homolog_perc_id_r1 %id. query gene identical to target Oryza meridionalis gene homologs
1153 omeridionalis_eg_homolog_wga_coverage Oryza meridionalis Whole-genome alignment coverage homologs
1154 omeridionalis_eg_homolog_orthology_confidence Oryza meridionalis orthology confidence [0 low, 1 high] homologs
1155 onivara_eg_homolog_ensembl_gene Oryza nivara gene stable ID homologs
1156 onivara_eg_homolog_associated_gene_name Oryza nivara gene name homologs
1157 onivara_eg_homolog_ensembl_peptide Oryza nivara protein or transcript stable ID homologs
1158 onivara_eg_homolog_chromosome Oryza nivara chromosome/scaffold name homologs
1159 onivara_eg_homolog_chrom_start Oryza nivara chromosome/scaffold start (bp) homologs
1160 onivara_eg_homolog_chrom_end Oryza nivara chromosome/scaffold end (bp) homologs
1161 onivara_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1162 onivara_eg_homolog_subtype Last common ancestor with Oryza nivara homologs
1163 onivara_eg_homolog_orthology_type Oryza nivara homology type homologs
1164 onivara_eg_homolog_perc_id %id. target Oryza nivara gene identical to query gene homologs
1165 onivara_eg_homolog_perc_id_r1 %id. query gene identical to target Oryza nivara gene homologs
1166 onivara_eg_homolog_wga_coverage Oryza nivara Whole-genome alignment coverage homologs
1167 onivara_eg_homolog_orthology_confidence Oryza nivara orthology confidence [0 low, 1 high] homologs
1168 opunctata_eg_homolog_ensembl_gene Oryza punctata gene stable ID homologs
1169 opunctata_eg_homolog_associated_gene_name Oryza punctata gene name homologs
1170 opunctata_eg_homolog_ensembl_peptide Oryza punctata protein or transcript stable ID homologs
1171 opunctata_eg_homolog_chromosome Oryza punctata chromosome/scaffold name homologs
1172 opunctata_eg_homolog_chrom_start Oryza punctata chromosome/scaffold start (bp) homologs
1173 opunctata_eg_homolog_chrom_end Oryza punctata chromosome/scaffold end (bp) homologs
1174 opunctata_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1175 opunctata_eg_homolog_subtype Last common ancestor with Oryza punctata homologs
1176 opunctata_eg_homolog_orthology_type Oryza punctata homology type homologs
1177 opunctata_eg_homolog_perc_id %id. target Oryza punctata gene identical to query gene homologs
1178 opunctata_eg_homolog_perc_id_r1 %id. query gene identical to target Oryza punctata gene homologs
1179 opunctata_eg_homolog_wga_coverage Oryza punctata Whole-genome alignment coverage homologs
1180 opunctata_eg_homolog_orthology_confidence Oryza punctata orthology confidence [0 low, 1 high] homologs
1181 orufipogon_eg_homolog_ensembl_gene Oryza rufipogon gene stable ID homologs
1182 orufipogon_eg_homolog_associated_gene_name Oryza rufipogon gene name homologs
1183 orufipogon_eg_homolog_ensembl_peptide Oryza rufipogon protein or transcript stable ID homologs
1184 orufipogon_eg_homolog_chromosome Oryza rufipogon chromosome/scaffold name homologs
1185 orufipogon_eg_homolog_chrom_start Oryza rufipogon chromosome/scaffold start (bp) homologs
1186 orufipogon_eg_homolog_chrom_end Oryza rufipogon chromosome/scaffold end (bp) homologs
1187 orufipogon_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1188 orufipogon_eg_homolog_subtype Last common ancestor with Oryza rufipogon homologs
1189 orufipogon_eg_homolog_orthology_type Oryza rufipogon homology type homologs
1190 orufipogon_eg_homolog_perc_id %id. target Oryza rufipogon gene identical to query gene homologs
1191 orufipogon_eg_homolog_perc_id_r1 %id. query gene identical to target Oryza rufipogon gene homologs
1192 orufipogon_eg_homolog_wga_coverage Oryza rufipogon Whole-genome alignment coverage homologs
1193 orufipogon_eg_homolog_orthology_confidence Oryza rufipogon orthology confidence [0 low, 1 high] homologs
1194 oindica_eg_homolog_ensembl_gene Oryza sativa Indica Group gene stable ID homologs
1195 oindica_eg_homolog_associated_gene_name Oryza sativa Indica Group gene name homologs
1196 oindica_eg_homolog_ensembl_peptide Oryza sativa Indica Group protein or transcript stable ID homologs
1197 oindica_eg_homolog_chromosome Oryza sativa Indica Group chromosome/scaffold name homologs
1198 oindica_eg_homolog_chrom_start Oryza sativa Indica Group chromosome/scaffold start (bp) homologs
1199 oindica_eg_homolog_chrom_end Oryza sativa Indica Group chromosome/scaffold end (bp) homologs
1200 oindica_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1201 oindica_eg_homolog_subtype Last common ancestor with Oryza sativa Indica Group homologs
1202 oindica_eg_homolog_orthology_type Oryza sativa Indica Group homology type homologs
1203 oindica_eg_homolog_perc_id %id. target Oryza sativa Indica Group gene identical to query gene homologs
1204 oindica_eg_homolog_perc_id_r1 %id. query gene identical to target Oryza sativa Indica Group gene homologs
1205 oindica_eg_homolog_wga_coverage Oryza sativa Indica Group Whole-genome alignment coverage homologs
1206 oindica_eg_homolog_orthology_confidence Oryza sativa Indica Group orthology confidence [0 low, 1 high] homologs
1207 osativa_eg_homolog_ensembl_gene Oryza sativa Japonica Group gene stable ID homologs
1208 osativa_eg_homolog_associated_gene_name Oryza sativa Japonica Group gene name homologs
1209 osativa_eg_homolog_ensembl_peptide Oryza sativa Japonica Group protein or transcript stable ID homologs
1210 osativa_eg_homolog_chromosome Oryza sativa Japonica Group chromosome/scaffold name homologs
1211 osativa_eg_homolog_chrom_start Oryza sativa Japonica Group chromosome/scaffold start (bp) homologs
1212 osativa_eg_homolog_chrom_end Oryza sativa Japonica Group chromosome/scaffold end (bp) homologs
1213 osativa_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1214 osativa_eg_homolog_subtype Last common ancestor with Oryza sativa Japonica Group homologs
1215 osativa_eg_homolog_orthology_type Oryza sativa Japonica Group homology type homologs
1216 osativa_eg_homolog_perc_id %id. target Oryza sativa Japonica Group gene identical to query gene homologs
1217 osativa_eg_homolog_perc_id_r1 %id. query gene identical to target Oryza sativa Japonica Group gene homologs
1218 osativa_eg_homolog_wga_coverage Oryza sativa Japonica Group Whole-genome alignment coverage homologs
1219 osativa_eg_homolog_orthology_confidence Oryza sativa Japonica Group orthology confidence [0 low, 1 high] homologs
1220 olucimarinus_eg_homolog_ensembl_gene Ostreococcus lucimarinus gene stable ID homologs
1221 olucimarinus_eg_homolog_associated_gene_name Ostreococcus lucimarinus gene name homologs
1222 olucimarinus_eg_homolog_ensembl_peptide Ostreococcus lucimarinus protein or transcript stable ID homologs
1223 olucimarinus_eg_homolog_chromosome Ostreococcus lucimarinus chromosome/scaffold name homologs
1224 olucimarinus_eg_homolog_chrom_start Ostreococcus lucimarinus chromosome/scaffold start (bp) homologs
1225 olucimarinus_eg_homolog_chrom_end Ostreococcus lucimarinus chromosome/scaffold end (bp) homologs
1226 olucimarinus_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1227 olucimarinus_eg_homolog_subtype Last common ancestor with Ostreococcus lucimarinus homologs
1228 olucimarinus_eg_homolog_orthology_type Ostreococcus lucimarinus homology type homologs
1229 olucimarinus_eg_homolog_perc_id %id. target Ostreococcus lucimarinus gene identical to query gene homologs
1230 olucimarinus_eg_homolog_perc_id_r1 %id. query gene identical to target Ostreococcus lucimarinus gene homologs
1231 olucimarinus_eg_homolog_orthology_confidence Ostreococcus lucimarinus orthology confidence [0 low, 1 high] homologs
1232 phallii_eg_homolog_ensembl_gene Panicum hallii HAL2 gene stable ID homologs
1233 phallii_eg_homolog_associated_gene_name Panicum hallii HAL2 gene name homologs
1234 phallii_eg_homolog_ensembl_peptide Panicum hallii HAL2 protein or transcript stable ID homologs
1235 phallii_eg_homolog_chromosome Panicum hallii HAL2 chromosome/scaffold name homologs
1236 phallii_eg_homolog_chrom_start Panicum hallii HAL2 chromosome/scaffold start (bp) homologs
1237 phallii_eg_homolog_chrom_end Panicum hallii HAL2 chromosome/scaffold end (bp) homologs
1238 phallii_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1239 phallii_eg_homolog_subtype Last common ancestor with Panicum hallii HAL2 homologs
1240 phallii_eg_homolog_orthology_type Panicum hallii HAL2 homology type homologs
1241 phallii_eg_homolog_perc_id %id. target Panicum hallii HAL2 gene identical to query gene homologs
1242 phallii_eg_homolog_perc_id_r1 %id. query gene identical to target Panicum hallii HAL2 gene homologs
1243 phallii_eg_homolog_wga_coverage Panicum hallii HAL2 Whole-genome alignment coverage homologs
1244 phallii_eg_homolog_orthology_confidence Panicum hallii HAL2 orthology confidence [0 low, 1 high] homologs
1245 psomniferum_eg_homolog_ensembl_gene Papaver somniferum gene stable ID homologs
1246 psomniferum_eg_homolog_associated_gene_name Papaver somniferum gene name homologs
1247 psomniferum_eg_homolog_ensembl_peptide Papaver somniferum protein or transcript stable ID homologs
1248 psomniferum_eg_homolog_chromosome Papaver somniferum chromosome/scaffold name homologs
1249 psomniferum_eg_homolog_chrom_start Papaver somniferum chromosome/scaffold start (bp) homologs
1250 psomniferum_eg_homolog_chrom_end Papaver somniferum chromosome/scaffold end (bp) homologs
1251 psomniferum_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1252 psomniferum_eg_homolog_subtype Last common ancestor with Papaver somniferum homologs
1253 psomniferum_eg_homolog_orthology_type Papaver somniferum homology type homologs
1254 psomniferum_eg_homolog_perc_id %id. target Papaver somniferum gene identical to query gene homologs
1255 psomniferum_eg_homolog_perc_id_r1 %id. query gene identical to target Papaver somniferum gene homologs
1256 psomniferum_eg_homolog_wga_coverage Papaver somniferum Whole-genome alignment coverage homologs
1257 psomniferum_eg_homolog_orthology_confidence Papaver somniferum orthology confidence [0 low, 1 high] homologs
1258 pvulgaris_eg_homolog_ensembl_gene Phaseolus vulgaris gene stable ID homologs
1259 pvulgaris_eg_homolog_associated_gene_name Phaseolus vulgaris gene name homologs
1260 pvulgaris_eg_homolog_ensembl_peptide Phaseolus vulgaris protein or transcript stable ID homologs
1261 pvulgaris_eg_homolog_chromosome Phaseolus vulgaris chromosome/scaffold name homologs
1262 pvulgaris_eg_homolog_chrom_start Phaseolus vulgaris chromosome/scaffold start (bp) homologs
1263 pvulgaris_eg_homolog_chrom_end Phaseolus vulgaris chromosome/scaffold end (bp) homologs
1264 pvulgaris_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1265 pvulgaris_eg_homolog_subtype Last common ancestor with Phaseolus vulgaris homologs
1266 pvulgaris_eg_homolog_orthology_type Phaseolus vulgaris homology type homologs
1267 pvulgaris_eg_homolog_perc_id %id. target Phaseolus vulgaris gene identical to query gene homologs
1268 pvulgaris_eg_homolog_perc_id_r1 %id. query gene identical to target Phaseolus vulgaris gene homologs
1269 pvulgaris_eg_homolog_wga_coverage Phaseolus vulgaris Whole-genome alignment coverage homologs
1270 pvulgaris_eg_homolog_orthology_confidence Phaseolus vulgaris orthology confidence [0 low, 1 high] homologs
1271 ppatens_eg_homolog_ensembl_gene Physcomitrium patens gene stable ID homologs
1272 ppatens_eg_homolog_associated_gene_name Physcomitrium patens gene name homologs
1273 ppatens_eg_homolog_ensembl_peptide Physcomitrium patens protein or transcript stable ID homologs
1274 ppatens_eg_homolog_chromosome Physcomitrium patens chromosome/scaffold name homologs
1275 ppatens_eg_homolog_chrom_start Physcomitrium patens chromosome/scaffold start (bp) homologs
1276 ppatens_eg_homolog_chrom_end Physcomitrium patens chromosome/scaffold end (bp) homologs
1277 ppatens_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1278 ppatens_eg_homolog_subtype Last common ancestor with Physcomitrium patens homologs
1279 ppatens_eg_homolog_orthology_type Physcomitrium patens homology type homologs
1280 ppatens_eg_homolog_perc_id %id. target Physcomitrium patens gene identical to query gene homologs
1281 ppatens_eg_homolog_perc_id_r1 %id. query gene identical to target Physcomitrium patens gene homologs
1282 ppatens_eg_homolog_wga_coverage Physcomitrium patens Whole-genome alignment coverage homologs
1283 ppatens_eg_homolog_orthology_confidence Physcomitrium patens orthology confidence [0 low, 1 high] homologs
1284 pvera_eg_homolog_ensembl_gene Pistacia vera gene stable ID homologs
1285 pvera_eg_homolog_associated_gene_name Pistacia vera gene name homologs
1286 pvera_eg_homolog_ensembl_peptide Pistacia vera protein or transcript stable ID homologs
1287 pvera_eg_homolog_chromosome Pistacia vera chromosome/scaffold name homologs
1288 pvera_eg_homolog_chrom_start Pistacia vera chromosome/scaffold start (bp) homologs
1289 pvera_eg_homolog_chrom_end Pistacia vera chromosome/scaffold end (bp) homologs
1290 pvera_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1291 pvera_eg_homolog_subtype Last common ancestor with Pistacia vera homologs
1292 pvera_eg_homolog_orthology_type Pistacia vera homology type homologs
1293 pvera_eg_homolog_perc_id %id. target Pistacia vera gene identical to query gene homologs
1294 pvera_eg_homolog_perc_id_r1 %id. query gene identical to target Pistacia vera gene homologs
1295 pvera_eg_homolog_wga_coverage Pistacia vera Whole-genome alignment coverage homologs
1296 pvera_eg_homolog_orthology_confidence Pistacia vera orthology confidence [0 low, 1 high] homologs
1297 psativum_eg_homolog_ensembl_gene Pisum sativum gene stable ID homologs
1298 psativum_eg_homolog_associated_gene_name Pisum sativum gene name homologs
1299 psativum_eg_homolog_ensembl_peptide Pisum sativum protein or transcript stable ID homologs
1300 psativum_eg_homolog_chromosome Pisum sativum chromosome/scaffold name homologs
1301 psativum_eg_homolog_chrom_start Pisum sativum chromosome/scaffold start (bp) homologs
1302 psativum_eg_homolog_chrom_end Pisum sativum chromosome/scaffold end (bp) homologs
1303 psativum_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1304 psativum_eg_homolog_subtype Last common ancestor with Pisum sativum homologs
1305 psativum_eg_homolog_orthology_type Pisum sativum homology type homologs
1306 psativum_eg_homolog_perc_id %id. target Pisum sativum gene identical to query gene homologs
1307 psativum_eg_homolog_perc_id_r1 %id. query gene identical to target Pisum sativum gene homologs
1308 psativum_eg_homolog_orthology_confidence Pisum sativum orthology confidence [0 low, 1 high] homologs
1309 psgca024323335v2gb_eg_homolog_ensembl_gene Pisum sativum Garden pea gene stable ID homologs
1310 psgca024323335v2gb_eg_homolog_associated_gene_name Pisum sativum Garden pea gene name homologs
1311 psgca024323335v2gb_eg_homolog_ensembl_peptide Pisum sativum Garden pea protein or transcript stable ID homologs
1312 psgca024323335v2gb_eg_homolog_chromosome Pisum sativum Garden pea chromosome/scaffold name homologs
1313 psgca024323335v2gb_eg_homolog_chrom_start Pisum sativum Garden pea chromosome/scaffold start (bp) homologs
1314 psgca024323335v2gb_eg_homolog_chrom_end Pisum sativum Garden pea chromosome/scaffold end (bp) homologs
1315 psgca024323335v2gb_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1316 psgca024323335v2gb_eg_homolog_subtype Last common ancestor with Pisum sativum Garden pea homologs
1317 psgca024323335v2gb_eg_homolog_orthology_type Pisum sativum Garden pea homology type homologs
1318 psgca024323335v2gb_eg_homolog_perc_id %id. target Pisum sativum Garden pea gene identical to query gene homologs
1319 psgca024323335v2gb_eg_homolog_perc_id_r1 %id. query gene identical to target Pisum sativum Garden pea gene homologs
1320 psgca024323335v2gb_eg_homolog_orthology_confidence Pisum sativum Garden pea orthology confidence [0 low, 1 high] homologs
1321 psgca964186695v1gb_eg_homolog_ensembl_gene Pisum sativum JI2822 gene stable ID homologs
1322 psgca964186695v1gb_eg_homolog_associated_gene_name Pisum sativum JI2822 gene name homologs
1323 psgca964186695v1gb_eg_homolog_ensembl_peptide Pisum sativum JI2822 protein or transcript stable ID homologs
1324 psgca964186695v1gb_eg_homolog_chromosome Pisum sativum JI2822 chromosome/scaffold name homologs
1325 psgca964186695v1gb_eg_homolog_chrom_start Pisum sativum JI2822 chromosome/scaffold start (bp) homologs
1326 psgca964186695v1gb_eg_homolog_chrom_end Pisum sativum JI2822 chromosome/scaffold end (bp) homologs
1327 psgca964186695v1gb_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1328 psgca964186695v1gb_eg_homolog_subtype Last common ancestor with Pisum sativum JI2822 homologs
1329 psgca964186695v1gb_eg_homolog_orthology_type Pisum sativum JI2822 homology type homologs
1330 psgca964186695v1gb_eg_homolog_perc_id %id. target Pisum sativum JI2822 gene identical to query gene homologs
1331 psgca964186695v1gb_eg_homolog_perc_id_r1 %id. query gene identical to target Pisum sativum JI2822 gene homologs
1332 psgca964186695v1gb_eg_homolog_orthology_confidence Pisum sativum JI2822 orthology confidence [0 low, 1 high] homologs
1333 ptrichocarpa_eg_homolog_ensembl_gene Populus trichocarpa gene stable ID homologs
1334 ptrichocarpa_eg_homolog_associated_gene_name Populus trichocarpa gene name homologs
1335 ptrichocarpa_eg_homolog_ensembl_peptide Populus trichocarpa protein or transcript stable ID homologs
1336 ptrichocarpa_eg_homolog_chromosome Populus trichocarpa chromosome/scaffold name homologs
1337 ptrichocarpa_eg_homolog_chrom_start Populus trichocarpa chromosome/scaffold start (bp) homologs
1338 ptrichocarpa_eg_homolog_chrom_end Populus trichocarpa chromosome/scaffold end (bp) homologs
1339 ptrichocarpa_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1340 ptrichocarpa_eg_homolog_subtype Last common ancestor with Populus trichocarpa homologs
1341 ptrichocarpa_eg_homolog_orthology_type Populus trichocarpa homology type homologs
1342 ptrichocarpa_eg_homolog_perc_id %id. target Populus trichocarpa gene identical to query gene homologs
1343 ptrichocarpa_eg_homolog_perc_id_r1 %id. query gene identical to target Populus trichocarpa gene homologs
1344 ptrichocarpa_eg_homolog_orthology_confidence Populus trichocarpa orthology confidence [0 low, 1 high] homologs
1345 pavium_eg_homolog_ensembl_gene Prunus avium gene stable ID homologs
1346 pavium_eg_homolog_associated_gene_name Prunus avium gene name homologs
1347 pavium_eg_homolog_ensembl_peptide Prunus avium protein or transcript stable ID homologs
1348 pavium_eg_homolog_chromosome Prunus avium chromosome/scaffold name homologs
1349 pavium_eg_homolog_chrom_start Prunus avium chromosome/scaffold start (bp) homologs
1350 pavium_eg_homolog_chrom_end Prunus avium chromosome/scaffold end (bp) homologs
1351 pavium_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1352 pavium_eg_homolog_subtype Last common ancestor with Prunus avium homologs
1353 pavium_eg_homolog_orthology_type Prunus avium homology type homologs
1354 pavium_eg_homolog_perc_id %id. target Prunus avium gene identical to query gene homologs
1355 pavium_eg_homolog_perc_id_r1 %id. query gene identical to target Prunus avium gene homologs
1356 pavium_eg_homolog_orthology_confidence Prunus avium orthology confidence [0 low, 1 high] homologs
1357 pdulcis_eg_homolog_ensembl_gene Prunus dulcis gene stable ID homologs
1358 pdulcis_eg_homolog_associated_gene_name Prunus dulcis gene name homologs
1359 pdulcis_eg_homolog_ensembl_peptide Prunus dulcis protein or transcript stable ID homologs
1360 pdulcis_eg_homolog_chromosome Prunus dulcis chromosome/scaffold name homologs
1361 pdulcis_eg_homolog_chrom_start Prunus dulcis chromosome/scaffold start (bp) homologs
1362 pdulcis_eg_homolog_chrom_end Prunus dulcis chromosome/scaffold end (bp) homologs
1363 pdulcis_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1364 pdulcis_eg_homolog_subtype Last common ancestor with Prunus dulcis homologs
1365 pdulcis_eg_homolog_orthology_type Prunus dulcis homology type homologs
1366 pdulcis_eg_homolog_perc_id %id. target Prunus dulcis gene identical to query gene homologs
1367 pdulcis_eg_homolog_perc_id_r1 %id. query gene identical to target Prunus dulcis gene homologs
1368 pdulcis_eg_homolog_wga_coverage Prunus dulcis Whole-genome alignment coverage homologs
1369 pdulcis_eg_homolog_orthology_confidence Prunus dulcis orthology confidence [0 low, 1 high] homologs
1370 ppersica_eg_homolog_ensembl_gene Prunus persica gene stable ID homologs
1371 ppersica_eg_homolog_associated_gene_name Prunus persica gene name homologs
1372 ppersica_eg_homolog_ensembl_peptide Prunus persica protein or transcript stable ID homologs
1373 ppersica_eg_homolog_chromosome Prunus persica chromosome/scaffold name homologs
1374 ppersica_eg_homolog_chrom_start Prunus persica chromosome/scaffold start (bp) homologs
1375 ppersica_eg_homolog_chrom_end Prunus persica chromosome/scaffold end (bp) homologs
1376 ppersica_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1377 ppersica_eg_homolog_subtype Last common ancestor with Prunus persica homologs
1378 ppersica_eg_homolog_orthology_type Prunus persica homology type homologs
1379 ppersica_eg_homolog_perc_id %id. target Prunus persica gene identical to query gene homologs
1380 ppersica_eg_homolog_perc_id_r1 %id. query gene identical to target Prunus persica gene homologs
1381 ppersica_eg_homolog_wga_coverage Prunus persica Whole-genome alignment coverage homologs
1382 ppersica_eg_homolog_orthology_confidence Prunus persica orthology confidence [0 low, 1 high] homologs
1383 qlobata_eg_homolog_ensembl_gene Quercus lobata gene stable ID homologs
1384 qlobata_eg_homolog_associated_gene_name Quercus lobata gene name homologs
1385 qlobata_eg_homolog_ensembl_peptide Quercus lobata protein or transcript stable ID homologs
1386 qlobata_eg_homolog_chromosome Quercus lobata chromosome/scaffold name homologs
1387 qlobata_eg_homolog_chrom_start Quercus lobata chromosome/scaffold start (bp) homologs
1388 qlobata_eg_homolog_chrom_end Quercus lobata chromosome/scaffold end (bp) homologs
1389 qlobata_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1390 qlobata_eg_homolog_subtype Last common ancestor with Quercus lobata homologs
1391 qlobata_eg_homolog_orthology_type Quercus lobata homology type homologs
1392 qlobata_eg_homolog_perc_id %id. target Quercus lobata gene identical to query gene homologs
1393 qlobata_eg_homolog_perc_id_r1 %id. query gene identical to target Quercus lobata gene homologs
1394 qlobata_eg_homolog_orthology_confidence Quercus lobata orthology confidence [0 low, 1 high] homologs
1395 qsuber_eg_homolog_ensembl_gene Quercus suber gene stable ID homologs
1396 qsuber_eg_homolog_associated_gene_name Quercus suber gene name homologs
1397 qsuber_eg_homolog_ensembl_peptide Quercus suber protein or transcript stable ID homologs
1398 qsuber_eg_homolog_chromosome Quercus suber chromosome/scaffold name homologs
1399 qsuber_eg_homolog_chrom_start Quercus suber chromosome/scaffold start (bp) homologs
1400 qsuber_eg_homolog_chrom_end Quercus suber chromosome/scaffold end (bp) homologs
1401 qsuber_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1402 qsuber_eg_homolog_subtype Last common ancestor with Quercus suber homologs
1403 qsuber_eg_homolog_orthology_type Quercus suber homology type homologs
1404 qsuber_eg_homolog_perc_id %id. target Quercus suber gene identical to query gene homologs
1405 qsuber_eg_homolog_perc_id_r1 %id. query gene identical to target Quercus suber gene homologs
1406 qsuber_eg_homolog_orthology_confidence Quercus suber orthology confidence [0 low, 1 high] homologs
1407 rchinensis_eg_homolog_ensembl_gene Rosa chinensis gene stable ID homologs
1408 rchinensis_eg_homolog_associated_gene_name Rosa chinensis gene name homologs
1409 rchinensis_eg_homolog_ensembl_peptide Rosa chinensis protein or transcript stable ID homologs
1410 rchinensis_eg_homolog_chromosome Rosa chinensis chromosome/scaffold name homologs
1411 rchinensis_eg_homolog_chrom_start Rosa chinensis chromosome/scaffold start (bp) homologs
1412 rchinensis_eg_homolog_chrom_end Rosa chinensis chromosome/scaffold end (bp) homologs
1413 rchinensis_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1414 rchinensis_eg_homolog_subtype Last common ancestor with Rosa chinensis homologs
1415 rchinensis_eg_homolog_orthology_type Rosa chinensis homology type homologs
1416 rchinensis_eg_homolog_perc_id %id. target Rosa chinensis gene identical to query gene homologs
1417 rchinensis_eg_homolog_perc_id_r1 %id. query gene identical to target Rosa chinensis gene homologs
1418 rchinensis_eg_homolog_wga_coverage Rosa chinensis Whole-genome alignment coverage homologs
1419 rchinensis_eg_homolog_orthology_confidence Rosa chinensis orthology confidence [0 low, 1 high] homologs
1420 sspontaneum_eg_homolog_ensembl_gene Saccharum spontaneum gene stable ID homologs
1421 sspontaneum_eg_homolog_associated_gene_name Saccharum spontaneum gene name homologs
1422 sspontaneum_eg_homolog_ensembl_peptide Saccharum spontaneum protein or transcript stable ID homologs
1423 sspontaneum_eg_homolog_chromosome Saccharum spontaneum chromosome/scaffold name homologs
1424 sspontaneum_eg_homolog_chrom_start Saccharum spontaneum chromosome/scaffold start (bp) homologs
1425 sspontaneum_eg_homolog_chrom_end Saccharum spontaneum chromosome/scaffold end (bp) homologs
1426 sspontaneum_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1427 sspontaneum_eg_homolog_subtype Last common ancestor with Saccharum spontaneum homologs
1428 sspontaneum_eg_homolog_orthology_type Saccharum spontaneum homology type homologs
1429 sspontaneum_eg_homolog_perc_id %id. target Saccharum spontaneum gene identical to query gene homologs
1430 sspontaneum_eg_homolog_perc_id_r1 %id. query gene identical to target Saccharum spontaneum gene homologs
1431 sspontaneum_eg_homolog_orthology_confidence Saccharum spontaneum orthology confidence [0 low, 1 high] homologs
1432 scereale_eg_homolog_ensembl_gene Secale cereale gene stable ID homologs
1433 scereale_eg_homolog_associated_gene_name Secale cereale gene name homologs
1434 scereale_eg_homolog_ensembl_peptide Secale cereale protein or transcript stable ID homologs
1435 scereale_eg_homolog_chromosome Secale cereale chromosome/scaffold name homologs
1436 scereale_eg_homolog_chrom_start Secale cereale chromosome/scaffold start (bp) homologs
1437 scereale_eg_homolog_chrom_end Secale cereale chromosome/scaffold end (bp) homologs
1438 scereale_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1439 scereale_eg_homolog_subtype Last common ancestor with Secale cereale homologs
1440 scereale_eg_homolog_orthology_type Secale cereale homology type homologs
1441 scereale_eg_homolog_perc_id %id. target Secale cereale gene identical to query gene homologs
1442 scereale_eg_homolog_perc_id_r1 %id. query gene identical to target Secale cereale gene homologs
1443 scereale_eg_homolog_orthology_confidence Secale cereale orthology confidence [0 low, 1 high] homologs
1444 smoellendorffii_eg_homolog_ensembl_gene Selaginella moellendorffii gene stable ID homologs
1445 smoellendorffii_eg_homolog_associated_gene_name Selaginella moellendorffii gene name homologs
1446 smoellendorffii_eg_homolog_ensembl_peptide Selaginella moellendorffii protein or transcript stable ID homologs
1447 smoellendorffii_eg_homolog_chromosome Selaginella moellendorffii chromosome/scaffold name homologs
1448 smoellendorffii_eg_homolog_chrom_start Selaginella moellendorffii chromosome/scaffold start (bp) homologs
1449 smoellendorffii_eg_homolog_chrom_end Selaginella moellendorffii chromosome/scaffold end (bp) homologs
1450 smoellendorffii_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1451 smoellendorffii_eg_homolog_subtype Last common ancestor with Selaginella moellendorffii homologs
1452 smoellendorffii_eg_homolog_orthology_type Selaginella moellendorffii homology type homologs
1453 smoellendorffii_eg_homolog_perc_id %id. target Selaginella moellendorffii gene identical to query gene homologs
1454 smoellendorffii_eg_homolog_perc_id_r1 %id. query gene identical to target Selaginella moellendorffii gene homologs
1455 smoellendorffii_eg_homolog_wga_coverage Selaginella moellendorffii Whole-genome alignment coverage homologs
1456 smoellendorffii_eg_homolog_orthology_confidence Selaginella moellendorffii orthology confidence [0 low, 1 high] homologs
1457 sindicum_eg_homolog_ensembl_gene Sesamum indicum gene stable ID homologs
1458 sindicum_eg_homolog_associated_gene_name Sesamum indicum gene name homologs
1459 sindicum_eg_homolog_ensembl_peptide Sesamum indicum protein or transcript stable ID homologs
1460 sindicum_eg_homolog_chromosome Sesamum indicum chromosome/scaffold name homologs
1461 sindicum_eg_homolog_chrom_start Sesamum indicum chromosome/scaffold start (bp) homologs
1462 sindicum_eg_homolog_chrom_end Sesamum indicum chromosome/scaffold end (bp) homologs
1463 sindicum_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1464 sindicum_eg_homolog_subtype Last common ancestor with Sesamum indicum homologs
1465 sindicum_eg_homolog_orthology_type Sesamum indicum homology type homologs
1466 sindicum_eg_homolog_perc_id %id. target Sesamum indicum gene identical to query gene homologs
1467 sindicum_eg_homolog_perc_id_r1 %id. query gene identical to target Sesamum indicum gene homologs
1468 sindicum_eg_homolog_orthology_confidence Sesamum indicum orthology confidence [0 low, 1 high] homologs
1469 sitalica_eg_homolog_ensembl_gene Setaria italica gene stable ID homologs
1470 sitalica_eg_homolog_associated_gene_name Setaria italica gene name homologs
1471 sitalica_eg_homolog_ensembl_peptide Setaria italica protein or transcript stable ID homologs
1472 sitalica_eg_homolog_chromosome Setaria italica chromosome/scaffold name homologs
1473 sitalica_eg_homolog_chrom_start Setaria italica chromosome/scaffold start (bp) homologs
1474 sitalica_eg_homolog_chrom_end Setaria italica chromosome/scaffold end (bp) homologs
1475 sitalica_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1476 sitalica_eg_homolog_subtype Last common ancestor with Setaria italica homologs
1477 sitalica_eg_homolog_orthology_type Setaria italica homology type homologs
1478 sitalica_eg_homolog_perc_id %id. target Setaria italica gene identical to query gene homologs
1479 sitalica_eg_homolog_perc_id_r1 %id. query gene identical to target Setaria italica gene homologs
1480 sitalica_eg_homolog_wga_coverage Setaria italica Whole-genome alignment coverage homologs
1481 sitalica_eg_homolog_orthology_confidence Setaria italica orthology confidence [0 low, 1 high] homologs
1482 sviridis_eg_homolog_ensembl_gene Setaria viridis gene stable ID homologs
1483 sviridis_eg_homolog_associated_gene_name Setaria viridis gene name homologs
1484 sviridis_eg_homolog_ensembl_peptide Setaria viridis protein or transcript stable ID homologs
1485 sviridis_eg_homolog_chromosome Setaria viridis chromosome/scaffold name homologs
1486 sviridis_eg_homolog_chrom_start Setaria viridis chromosome/scaffold start (bp) homologs
1487 sviridis_eg_homolog_chrom_end Setaria viridis chromosome/scaffold end (bp) homologs
1488 sviridis_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1489 sviridis_eg_homolog_subtype Last common ancestor with Setaria viridis homologs
1490 sviridis_eg_homolog_orthology_type Setaria viridis homology type homologs
1491 sviridis_eg_homolog_perc_id %id. target Setaria viridis gene identical to query gene homologs
1492 sviridis_eg_homolog_perc_id_r1 %id. query gene identical to target Setaria viridis gene homologs
1493 sviridis_eg_homolog_wga_coverage Setaria viridis Whole-genome alignment coverage homologs
1494 sviridis_eg_homolog_orthology_confidence Setaria viridis orthology confidence [0 low, 1 high] homologs
1495 slycopersicum_eg_homolog_ensembl_gene Solanum lycopersicum gene stable ID homologs
1496 slycopersicum_eg_homolog_associated_gene_name Solanum lycopersicum gene name homologs
1497 slycopersicum_eg_homolog_ensembl_peptide Solanum lycopersicum protein or transcript stable ID homologs
1498 slycopersicum_eg_homolog_chromosome Solanum lycopersicum chromosome/scaffold name homologs
1499 slycopersicum_eg_homolog_chrom_start Solanum lycopersicum chromosome/scaffold start (bp) homologs
1500 slycopersicum_eg_homolog_chrom_end Solanum lycopersicum chromosome/scaffold end (bp) homologs
1501 slycopersicum_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1502 slycopersicum_eg_homolog_subtype Last common ancestor with Solanum lycopersicum homologs
1503 slycopersicum_eg_homolog_orthology_type Solanum lycopersicum homology type homologs
1504 slycopersicum_eg_homolog_perc_id %id. target Solanum lycopersicum gene identical to query gene homologs
1505 slycopersicum_eg_homolog_perc_id_r1 %id. query gene identical to target Solanum lycopersicum gene homologs
1506 slycopersicum_eg_homolog_wga_coverage Solanum lycopersicum Whole-genome alignment coverage homologs
1507 slycopersicum_eg_homolog_orthology_confidence Solanum lycopersicum orthology confidence [0 low, 1 high] homologs
1508 stuberosum_eg_homolog_ensembl_gene Solanum tuberosum gene stable ID homologs
1509 stuberosum_eg_homolog_associated_gene_name Solanum tuberosum gene name homologs
1510 stuberosum_eg_homolog_ensembl_peptide Solanum tuberosum protein or transcript stable ID homologs
1511 stuberosum_eg_homolog_chromosome Solanum tuberosum chromosome/scaffold name homologs
1512 stuberosum_eg_homolog_chrom_start Solanum tuberosum chromosome/scaffold start (bp) homologs
1513 stuberosum_eg_homolog_chrom_end Solanum tuberosum chromosome/scaffold end (bp) homologs
1514 stuberosum_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1515 stuberosum_eg_homolog_subtype Last common ancestor with Solanum tuberosum homologs
1516 stuberosum_eg_homolog_orthology_type Solanum tuberosum homology type homologs
1517 stuberosum_eg_homolog_perc_id %id. target Solanum tuberosum gene identical to query gene homologs
1518 stuberosum_eg_homolog_perc_id_r1 %id. query gene identical to target Solanum tuberosum gene homologs
1519 stuberosum_eg_homolog_wga_coverage Solanum tuberosum Whole-genome alignment coverage homologs
1520 stuberosum_eg_homolog_orthology_confidence Solanum tuberosum orthology confidence [0 low, 1 high] homologs
1521 sbicolor_eg_homolog_ensembl_gene Sorghum bicolor gene stable ID homologs
1522 sbicolor_eg_homolog_associated_gene_name Sorghum bicolor gene name homologs
1523 sbicolor_eg_homolog_ensembl_peptide Sorghum bicolor protein or transcript stable ID homologs
1524 sbicolor_eg_homolog_chromosome Sorghum bicolor chromosome/scaffold name homologs
1525 sbicolor_eg_homolog_chrom_start Sorghum bicolor chromosome/scaffold start (bp) homologs
1526 sbicolor_eg_homolog_chrom_end Sorghum bicolor chromosome/scaffold end (bp) homologs
1527 sbicolor_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1528 sbicolor_eg_homolog_subtype Last common ancestor with Sorghum bicolor homologs
1529 sbicolor_eg_homolog_orthology_type Sorghum bicolor homology type homologs
1530 sbicolor_eg_homolog_perc_id %id. target Sorghum bicolor gene identical to query gene homologs
1531 sbicolor_eg_homolog_perc_id_r1 %id. query gene identical to target Sorghum bicolor gene homologs
1532 sbicolor_eg_homolog_wga_coverage Sorghum bicolor Whole-genome alignment coverage homologs
1533 sbicolor_eg_homolog_orthology_confidence Sorghum bicolor orthology confidence [0 low, 1 high] homologs
1534 sstenocarpa_eg_homolog_ensembl_gene Sphenostylis stenocarpa gene stable ID homologs
1535 sstenocarpa_eg_homolog_associated_gene_name Sphenostylis stenocarpa gene name homologs
1536 sstenocarpa_eg_homolog_ensembl_peptide Sphenostylis stenocarpa protein or transcript stable ID homologs
1537 sstenocarpa_eg_homolog_chromosome Sphenostylis stenocarpa chromosome/scaffold name homologs
1538 sstenocarpa_eg_homolog_chrom_start Sphenostylis stenocarpa chromosome/scaffold start (bp) homologs
1539 sstenocarpa_eg_homolog_chrom_end Sphenostylis stenocarpa chromosome/scaffold end (bp) homologs
1540 sstenocarpa_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1541 sstenocarpa_eg_homolog_subtype Last common ancestor with Sphenostylis stenocarpa homologs
1542 sstenocarpa_eg_homolog_orthology_type Sphenostylis stenocarpa homology type homologs
1543 sstenocarpa_eg_homolog_perc_id %id. target Sphenostylis stenocarpa gene identical to query gene homologs
1544 sstenocarpa_eg_homolog_perc_id_r1 %id. query gene identical to target Sphenostylis stenocarpa gene homologs
1545 sstenocarpa_eg_homolog_orthology_confidence Sphenostylis stenocarpa orthology confidence [0 low, 1 high] homologs
1546 tcacao_eg_homolog_ensembl_gene Theobroma cacao Matina 1-6 gene stable ID homologs
1547 tcacao_eg_homolog_associated_gene_name Theobroma cacao Matina 1-6 gene name homologs
1548 tcacao_eg_homolog_ensembl_peptide Theobroma cacao Matina 1-6 protein or transcript stable ID homologs
1549 tcacao_eg_homolog_chromosome Theobroma cacao Matina 1-6 chromosome/scaffold name homologs
1550 tcacao_eg_homolog_chrom_start Theobroma cacao Matina 1-6 chromosome/scaffold start (bp) homologs
1551 tcacao_eg_homolog_chrom_end Theobroma cacao Matina 1-6 chromosome/scaffold end (bp) homologs
1552 tcacao_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1553 tcacao_eg_homolog_subtype Last common ancestor with Theobroma cacao Matina 1-6 homologs
1554 tcacao_eg_homolog_orthology_type Theobroma cacao Matina 1-6 homology type homologs
1555 tcacao_eg_homolog_perc_id %id. target Theobroma cacao Matina 1-6 gene identical to query gene homologs
1556 tcacao_eg_homolog_perc_id_r1 %id. query gene identical to target Theobroma cacao Matina 1-6 gene homologs
1557 tcacao_eg_homolog_wga_coverage Theobroma cacao Matina 1-6 Whole-genome alignment coverage homologs
1558 tcacao_eg_homolog_orthology_confidence Theobroma cacao Matina 1-6 orthology confidence [0 low, 1 high] homologs
1559 tpratense_eg_homolog_ensembl_gene Trifolium pratense gene stable ID homologs
1560 tpratense_eg_homolog_associated_gene_name Trifolium pratense gene name homologs
1561 tpratense_eg_homolog_ensembl_peptide Trifolium pratense protein or transcript stable ID homologs
1562 tpratense_eg_homolog_chromosome Trifolium pratense chromosome/scaffold name homologs
1563 tpratense_eg_homolog_chrom_start Trifolium pratense chromosome/scaffold start (bp) homologs
1564 tpratense_eg_homolog_chrom_end Trifolium pratense chromosome/scaffold end (bp) homologs
1565 tpratense_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1566 tpratense_eg_homolog_subtype Last common ancestor with Trifolium pratense homologs
1567 tpratense_eg_homolog_orthology_type Trifolium pratense homology type homologs
1568 tpratense_eg_homolog_perc_id %id. target Trifolium pratense gene identical to query gene homologs
1569 tpratense_eg_homolog_perc_id_r1 %id. query gene identical to target Trifolium pratense gene homologs
1570 tpratense_eg_homolog_wga_coverage Trifolium pratense Whole-genome alignment coverage homologs
1571 tpratense_eg_homolog_orthology_confidence Trifolium pratense orthology confidence [0 low, 1 high] homologs
1572 taestivum_eg_homolog_ensembl_gene Triticum aestivum gene stable ID homologs
1573 taestivum_eg_homolog_associated_gene_name Triticum aestivum gene name homologs
1574 taestivum_eg_homolog_ensembl_peptide Triticum aestivum protein or transcript stable ID homologs
1575 taestivum_eg_homolog_chromosome Triticum aestivum chromosome/scaffold name homologs
1576 taestivum_eg_homolog_chrom_start Triticum aestivum chromosome/scaffold start (bp) homologs
1577 taestivum_eg_homolog_chrom_end Triticum aestivum chromosome/scaffold end (bp) homologs
1578 taestivum_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1579 taestivum_eg_homolog_subtype Last common ancestor with Triticum aestivum homologs
1580 taestivum_eg_homolog_orthology_type Triticum aestivum homology type homologs
1581 taestivum_eg_homolog_perc_id %id. target Triticum aestivum gene identical to query gene homologs
1582 taestivum_eg_homolog_perc_id_r1 %id. query gene identical to target Triticum aestivum gene homologs
1583 taestivum_eg_homolog_wga_coverage Triticum aestivum Whole-genome alignment coverage homologs
1584 taestivum_eg_homolog_orthology_confidence Triticum aestivum orthology confidence [0 low, 1 high] homologs
1585 tdicoccoides_eg_homolog_ensembl_gene Triticum dicoccoides gene stable ID homologs
1586 tdicoccoides_eg_homolog_associated_gene_name Triticum dicoccoides gene name homologs
1587 tdicoccoides_eg_homolog_ensembl_peptide Triticum dicoccoides protein or transcript stable ID homologs
1588 tdicoccoides_eg_homolog_chromosome Triticum dicoccoides chromosome/scaffold name homologs
1589 tdicoccoides_eg_homolog_chrom_start Triticum dicoccoides chromosome/scaffold start (bp) homologs
1590 tdicoccoides_eg_homolog_chrom_end Triticum dicoccoides chromosome/scaffold end (bp) homologs
1591 tdicoccoides_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1592 tdicoccoides_eg_homolog_subtype Last common ancestor with Triticum dicoccoides homologs
1593 tdicoccoides_eg_homolog_orthology_type Triticum dicoccoides homology type homologs
1594 tdicoccoides_eg_homolog_perc_id %id. target Triticum dicoccoides gene identical to query gene homologs
1595 tdicoccoides_eg_homolog_perc_id_r1 %id. query gene identical to target Triticum dicoccoides gene homologs
1596 tdicoccoides_eg_homolog_wga_coverage Triticum dicoccoides Whole-genome alignment coverage homologs
1597 tdicoccoides_eg_homolog_orthology_confidence Triticum dicoccoides orthology confidence [0 low, 1 high] homologs
1598 tspelta_eg_homolog_ensembl_gene Triticum spelta gene stable ID homologs
1599 tspelta_eg_homolog_associated_gene_name Triticum spelta gene name homologs
1600 tspelta_eg_homolog_ensembl_peptide Triticum spelta protein or transcript stable ID homologs
1601 tspelta_eg_homolog_chromosome Triticum spelta chromosome/scaffold name homologs
1602 tspelta_eg_homolog_chrom_start Triticum spelta chromosome/scaffold start (bp) homologs
1603 tspelta_eg_homolog_chrom_end Triticum spelta chromosome/scaffold end (bp) homologs
1604 tspelta_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1605 tspelta_eg_homolog_subtype Last common ancestor with Triticum spelta homologs
1606 tspelta_eg_homolog_orthology_type Triticum spelta homology type homologs
1607 tspelta_eg_homolog_perc_id %id. target Triticum spelta gene identical to query gene homologs
1608 tspelta_eg_homolog_perc_id_r1 %id. query gene identical to target Triticum spelta gene homologs
1609 tspelta_eg_homolog_orthology_confidence Triticum spelta orthology confidence [0 low, 1 high] homologs
1610 ttimopheevii_eg_homolog_ensembl_gene Triticum timopheevii gene stable ID homologs
1611 ttimopheevii_eg_homolog_associated_gene_name Triticum timopheevii gene name homologs
1612 ttimopheevii_eg_homolog_ensembl_peptide Triticum timopheevii protein or transcript stable ID homologs
1613 ttimopheevii_eg_homolog_chromosome Triticum timopheevii chromosome/scaffold name homologs
1614 ttimopheevii_eg_homolog_chrom_start Triticum timopheevii chromosome/scaffold start (bp) homologs
1615 ttimopheevii_eg_homolog_chrom_end Triticum timopheevii chromosome/scaffold end (bp) homologs
1616 ttimopheevii_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1617 ttimopheevii_eg_homolog_subtype Last common ancestor with Triticum timopheevii homologs
1618 ttimopheevii_eg_homolog_orthology_type Triticum timopheevii homology type homologs
1619 ttimopheevii_eg_homolog_perc_id %id. target Triticum timopheevii gene identical to query gene homologs
1620 ttimopheevii_eg_homolog_perc_id_r1 %id. query gene identical to target Triticum timopheevii gene homologs
1621 ttimopheevii_eg_homolog_orthology_confidence Triticum timopheevii orthology confidence [0 low, 1 high] homologs
1622 tturgidum_eg_homolog_ensembl_gene Triticum turgidum gene stable ID homologs
1623 tturgidum_eg_homolog_associated_gene_name Triticum turgidum gene name homologs
1624 tturgidum_eg_homolog_ensembl_peptide Triticum turgidum protein or transcript stable ID homologs
1625 tturgidum_eg_homolog_chromosome Triticum turgidum chromosome/scaffold name homologs
1626 tturgidum_eg_homolog_chrom_start Triticum turgidum chromosome/scaffold start (bp) homologs
1627 tturgidum_eg_homolog_chrom_end Triticum turgidum chromosome/scaffold end (bp) homologs
1628 tturgidum_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1629 tturgidum_eg_homolog_subtype Last common ancestor with Triticum turgidum homologs
1630 tturgidum_eg_homolog_orthology_type Triticum turgidum homology type homologs
1631 tturgidum_eg_homolog_perc_id %id. target Triticum turgidum gene identical to query gene homologs
1632 tturgidum_eg_homolog_perc_id_r1 %id. query gene identical to target Triticum turgidum gene homologs
1633 tturgidum_eg_homolog_wga_coverage Triticum turgidum Whole-genome alignment coverage homologs
1634 tturgidum_eg_homolog_orthology_confidence Triticum turgidum orthology confidence [0 low, 1 high] homologs
1635 turartu_eg_homolog_ensembl_gene Triticum urartu gene stable ID homologs
1636 turartu_eg_homolog_associated_gene_name Triticum urartu gene name homologs
1637 turartu_eg_homolog_ensembl_peptide Triticum urartu protein or transcript stable ID homologs
1638 turartu_eg_homolog_chromosome Triticum urartu chromosome/scaffold name homologs
1639 turartu_eg_homolog_chrom_start Triticum urartu chromosome/scaffold start (bp) homologs
1640 turartu_eg_homolog_chrom_end Triticum urartu chromosome/scaffold end (bp) homologs
1641 turartu_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1642 turartu_eg_homolog_subtype Last common ancestor with Triticum urartu homologs
1643 turartu_eg_homolog_orthology_type Triticum urartu homology type homologs
1644 turartu_eg_homolog_perc_id %id. target Triticum urartu gene identical to query gene homologs
1645 turartu_eg_homolog_perc_id_r1 %id. query gene identical to target Triticum urartu gene homologs
1646 turartu_eg_homolog_orthology_confidence Triticum urartu orthology confidence [0 low, 1 high] homologs
1647 vfaba_eg_homolog_ensembl_gene Vicia faba gene stable ID homologs
1648 vfaba_eg_homolog_associated_gene_name Vicia faba gene name homologs
1649 vfaba_eg_homolog_ensembl_peptide Vicia faba protein or transcript stable ID homologs
1650 vfaba_eg_homolog_chromosome Vicia faba chromosome/scaffold name homologs
1651 vfaba_eg_homolog_chrom_start Vicia faba chromosome/scaffold start (bp) homologs
1652 vfaba_eg_homolog_chrom_end Vicia faba chromosome/scaffold end (bp) homologs
1653 vfaba_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1654 vfaba_eg_homolog_subtype Last common ancestor with Vicia faba homologs
1655 vfaba_eg_homolog_orthology_type Vicia faba homology type homologs
1656 vfaba_eg_homolog_perc_id %id. target Vicia faba gene identical to query gene homologs
1657 vfaba_eg_homolog_perc_id_r1 %id. query gene identical to target Vicia faba gene homologs
1658 vfaba_eg_homolog_orthology_confidence Vicia faba orthology confidence [0 low, 1 high] homologs
1659 vangularis_eg_homolog_ensembl_gene Vigna angularis gene stable ID homologs
1660 vangularis_eg_homolog_associated_gene_name Vigna angularis gene name homologs
1661 vangularis_eg_homolog_ensembl_peptide Vigna angularis protein or transcript stable ID homologs
1662 vangularis_eg_homolog_chromosome Vigna angularis chromosome/scaffold name homologs
1663 vangularis_eg_homolog_chrom_start Vigna angularis chromosome/scaffold start (bp) homologs
1664 vangularis_eg_homolog_chrom_end Vigna angularis chromosome/scaffold end (bp) homologs
1665 vangularis_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1666 vangularis_eg_homolog_subtype Last common ancestor with Vigna angularis homologs
1667 vangularis_eg_homolog_orthology_type Vigna angularis homology type homologs
1668 vangularis_eg_homolog_perc_id %id. target Vigna angularis gene identical to query gene homologs
1669 vangularis_eg_homolog_perc_id_r1 %id. query gene identical to target Vigna angularis gene homologs
1670 vangularis_eg_homolog_wga_coverage Vigna angularis Whole-genome alignment coverage homologs
1671 vangularis_eg_homolog_orthology_confidence Vigna angularis orthology confidence [0 low, 1 high] homologs
1672 vradiata_eg_homolog_ensembl_gene Vigna radiata gene stable ID homologs
1673 vradiata_eg_homolog_associated_gene_name Vigna radiata gene name homologs
1674 vradiata_eg_homolog_ensembl_peptide Vigna radiata protein or transcript stable ID homologs
1675 vradiata_eg_homolog_chromosome Vigna radiata chromosome/scaffold name homologs
1676 vradiata_eg_homolog_chrom_start Vigna radiata chromosome/scaffold start (bp) homologs
1677 vradiata_eg_homolog_chrom_end Vigna radiata chromosome/scaffold end (bp) homologs
1678 vradiata_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1679 vradiata_eg_homolog_subtype Last common ancestor with Vigna radiata homologs
1680 vradiata_eg_homolog_orthology_type Vigna radiata homology type homologs
1681 vradiata_eg_homolog_perc_id %id. target Vigna radiata gene identical to query gene homologs
1682 vradiata_eg_homolog_perc_id_r1 %id. query gene identical to target Vigna radiata gene homologs
1683 vradiata_eg_homolog_wga_coverage Vigna radiata Whole-genome alignment coverage homologs
1684 vradiata_eg_homolog_orthology_confidence Vigna radiata orthology confidence [0 low, 1 high] homologs
1685 vunguiculata_eg_homolog_ensembl_gene Vigna unguiculata gene stable ID homologs
1686 vunguiculata_eg_homolog_associated_gene_name Vigna unguiculata gene name homologs
1687 vunguiculata_eg_homolog_ensembl_peptide Vigna unguiculata protein or transcript stable ID homologs
1688 vunguiculata_eg_homolog_chromosome Vigna unguiculata chromosome/scaffold name homologs
1689 vunguiculata_eg_homolog_chrom_start Vigna unguiculata chromosome/scaffold start (bp) homologs
1690 vunguiculata_eg_homolog_chrom_end Vigna unguiculata chromosome/scaffold end (bp) homologs
1691 vunguiculata_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1692 vunguiculata_eg_homolog_subtype Last common ancestor with Vigna unguiculata homologs
1693 vunguiculata_eg_homolog_orthology_type Vigna unguiculata homology type homologs
1694 vunguiculata_eg_homolog_perc_id %id. target Vigna unguiculata gene identical to query gene homologs
1695 vunguiculata_eg_homolog_perc_id_r1 %id. query gene identical to target Vigna unguiculata gene homologs
1696 vunguiculata_eg_homolog_orthology_confidence Vigna unguiculata orthology confidence [0 low, 1 high] homologs
1697 vvinifera_eg_homolog_ensembl_gene Vitis vinifera gene stable ID homologs
1698 vvinifera_eg_homolog_associated_gene_name Vitis vinifera gene name homologs
1699 vvinifera_eg_homolog_ensembl_peptide Vitis vinifera protein or transcript stable ID homologs
1700 vvinifera_eg_homolog_chromosome Vitis vinifera chromosome/scaffold name homologs
1701 vvinifera_eg_homolog_chrom_start Vitis vinifera chromosome/scaffold start (bp) homologs
1702 vvinifera_eg_homolog_chrom_end Vitis vinifera chromosome/scaffold end (bp) homologs
1703 vvinifera_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1704 vvinifera_eg_homolog_subtype Last common ancestor with Vitis vinifera homologs
1705 vvinifera_eg_homolog_orthology_type Vitis vinifera homology type homologs
1706 vvinifera_eg_homolog_perc_id %id. target Vitis vinifera gene identical to query gene homologs
1707 vvinifera_eg_homolog_perc_id_r1 %id. query gene identical to target Vitis vinifera gene homologs
1708 vvinifera_eg_homolog_wga_coverage Vitis vinifera Whole-genome alignment coverage homologs
1709 vvinifera_eg_homolog_orthology_confidence Vitis vinifera orthology confidence [0 low, 1 high] homologs
1710 zmays_eg_homolog_ensembl_gene Zea mays gene stable ID homologs
1711 zmays_eg_homolog_associated_gene_name Zea mays gene name homologs
1712 zmays_eg_homolog_ensembl_peptide Zea mays protein or transcript stable ID homologs
1713 zmays_eg_homolog_chromosome Zea mays chromosome/scaffold name homologs
1714 zmays_eg_homolog_chrom_start Zea mays chromosome/scaffold start (bp) homologs
1715 zmays_eg_homolog_chrom_end Zea mays chromosome/scaffold end (bp) homologs
1716 zmays_eg_homolog_canonical_transcript_protein Query protein or transcript ID homologs
1717 zmays_eg_homolog_subtype Last common ancestor with Zea mays homologs
1718 zmays_eg_homolog_orthology_type Zea mays homology type homologs
1719 zmays_eg_homolog_perc_id %id. target Zea mays gene identical to query gene homologs
1720 zmays_eg_homolog_perc_id_r1 %id. query gene identical to target Zea mays gene homologs
1721 zmays_eg_homolog_orthology_confidence Zea mays orthology confidence [0 low, 1 high] homologs
1722 athaliana_eg_paralog_ensembl_gene Arabidopsis thaliana paralogue gene stable ID homologs
1723 athaliana_eg_paralog_associated_gene_name Arabidopsis thaliana paralogue associated gene name homologs
1724 athaliana_eg_paralog_ensembl_peptide Arabidopsis thaliana paralogue protein or transcript ID homologs
1725 athaliana_eg_paralog_chromosome Arabidopsis thaliana paralogue chromosome/scaffold name homologs
1726 athaliana_eg_paralog_chrom_start Arabidopsis thaliana paralogue chromosome/scaffold start (bp) homologs
1727 athaliana_eg_paralog_chrom_end Arabidopsis thaliana paralogue chromosome/scaffold end (bp) homologs
1728 athaliana_eg_paralog_canonical_transcript_protein Paralogue query protein or transcript ID homologs
1729 athaliana_eg_paralog_subtype Paralogue last common ancestor with Arabidopsis thaliana homologs
1730 athaliana_eg_paralog_orthology_type Arabidopsis thaliana paralogue homology type homologs
1731 athaliana_eg_paralog_perc_id Paralogue %id. target Arabidopsis thaliana gene identical to query gene homologs
1732 athaliana_eg_paralog_perc_id_r1 Paralogue %id. query gene identical to target Arabidopsis thaliana gene homologs
1733 ensembl_gene_id Gene stable ID snp
1734 ensembl_transcript_id Transcript stable ID snp
1735 ensembl_peptide_id Protein stable ID snp
1736 chromosome_name Chromosome/scaffold name snp
1737 start_position Gene start (bp) snp
1738 end_position Gene end (bp) snp
1739 strand Strand snp
1740 band Karyotype band snp
1741 external_gene_name Gene name snp
1742 external_gene_source Source of gene name snp
1743 transcript_count Transcript count snp
1744 percentage_gene_gc_content Gene % GC content snp
1745 description Gene description snp
1746 variation_name Variant name snp
1747 germ_line_variation_source Variant source snp
1748 source_description Variant source description snp
1749 allele Variant alleles snp
1750 validated Variant supporting evidence snp
1751 mapweight Mapweight snp
1752 minor_allele Minor allele snp
1753 minor_allele_freq Minor allele frequency snp
1754 minor_allele_count Minor allele count snp
1755 clinical_significance Clinical significance snp
1756 transcript_location Transcript location (bp) snp
1757 snp_chromosome_strand Variant chromosome Strand snp
1758 peptide_location Protein location (aa) snp
1759 chromosome_start chromosome/scaffold position start (bp) snp
1760 chromosome_end Chromosome/scaffold position end (bp) snp
1761 polyphen_prediction_2076 PolyPhen prediction snp
1762 polyphen_score_2076 PolyPhen score snp
1763 sift_prediction_2076 SIFT prediction snp
1764 sift_score_2076 SIFT score snp
1765 distance_to_transcript_2076 Distance to transcript snp
1766 cds_start_2076 CDS start snp
1767 cds_end_2076 CDS end snp
1768 peptide_shift Protein allele snp
1769 synonymous_status Variant consequence snp
1770 allele_string_2076 Consequence specific allele snp
1771 transcript_exon_intron Unspliced (Transcript) sequences
1772 gene_exon_intron Unspliced (Gene) sequences
1773 transcript_flank Flank (Transcript) sequences
1774 gene_flank Flank (Gene) sequences
1775 coding_transcript_flank Flank-coding region (Transcript) sequences
1776 coding_gene_flank Flank-coding region (Gene) sequences
1777 5utr 5' UTR sequences
1778 3utr 3' UTR sequences
1779 gene_exon Exon sequences sequences
1780 cdna cDNA sequences sequences
1781 coding Coding sequence sequences
1782 peptide Peptide sequences
1783 upstream_flank upstream_flank sequences
1784 downstream_flank downstream_flank sequences
1785 ensembl_gene_id Gene stable ID sequences
1786 description Gene description sequences
1787 external_gene_name Gene name sequences
1788 external_gene_source Source of gene name sequences
1789 chromosome_name Chromosome/scaffold name sequences
1790 start_position Gene start (bp) sequences
1791 end_position Gene end (bp) sequences
1792 gene_biotype Gene type sequences
1793 uniparc UniParc ID sequences
1794 uniprotswissprot UniProtKB/Swiss-Prot ID sequences
1795 uniprotsptrembl UniProtKB/TrEMBL ID sequences
1796 cdna_coding_start CDS start (within cDNA) sequences
1797 cdna_coding_end CDS end (within cDNA) sequences
1798 5_utr_start 5' UTR start sequences
1799 5_utr_end 5' UTR end sequences
1800 3_utr_start 3' UTR start sequences
1801 3_utr_end 3' UTR end sequences
1802 ensembl_transcript_id Transcript stable ID sequences
1803 ensembl_peptide_id Protein stable ID sequences
1804 transcript_biotype Transcript type sequences
1805 strand Strand sequences
1806 transcript_start Transcript start (bp) sequences
1807 transcript_end Transcript end (bp) sequences
1808 transcription_start_site Transcription start site (TSS) sequences
1809 transcript_length Transcript length (including UTRs and CDS) sequences
1810 cds_length CDS Length sequences
1811 cds_start CDS start sequences
1812 cds_end CDS end sequences
1813 ensembl_exon_id Exon stable ID sequences
1814 exon_chrom_start Exon region start (bp) sequences
1815 exon_chrom_end Exon region end (bp) sequences
1816 strand Strand sequences
1817 rank Exon rank in transcript sequences
1818 phase Start phase sequences
1819 end_phase End phase sequences
1820 cdna_coding_start cDNA coding start sequences
1821 cdna_coding_end cDNA coding end sequences
1822 genomic_coding_start Genomic coding start sequences
1823 genomic_coding_end Genomic coding end sequences
1824 is_constitutive Constitutive exon sequences ensembl_gene_id description
1 AT3G11415 ncRNA [Source:NCBI gene (formerly Entrezgene);Acc:10723045]
2 AT1G31258 ncRNA [Source:NCBI gene (formerly Entrezgene);Acc:5007746]
3 AT5G24735 ncRNA [Source:NCBI gene (formerly Entrezgene);Acc:5008225]
4 AT2G45780 ncRNA [Source:NCBI gene (formerly Entrezgene);Acc:819186]Efficient Sequence Parsing from Genome Files
getSeq — parse sequences for any GRanges annotations
Parse all ranges defined in a GRanges object from a genome FASTA file:
library(Biostrings); library(Rsamtools)
# Create a random test genome and write to file
gff <- gff[values(gff)$type != "chromosome"]
rand <- DNAStringSet(sapply(
unique(as.character(seqnames(gff))),
function(x) paste(sample(c("A","T","G","C"), 200000, replace=TRUE), collapse="")
))
writeXStringSet(DNAStringSet(rand), "./data/test")
# Parse sequences for all annotated ranges
getSeq(FaFile("./data/test"), gff)DNAStringSet object of length 442:
width seq names
[1] 2269 TTTAAGTTAATCATAACGGCGCTTAGGACCATGAGCACTAGAGTATGCTACGTCAATTGCTTTGGGCGTGTTGAAGTAGTGGATCAAATGAG...GCGAGACGTTCCCATCTGTTCGCTGGTACAAGCTGTAATCTAAGTTAAAGCAGACCATGTAAATAGAACTGGACATAGGACTAATTCAGCCA Chr1
[2] 2269 TTTAAGTTAATCATAACGGCGCTTAGGACCATGAGCACTAGAGTATGCTACGTCAATTGCTTTGGGCGTGTTGAAGTAGTGGATCAAATGAG...GCGAGACGTTCCCATCTGTTCGCTGGTACAAGCTGTAATCTAAGTTAAAGCAGACCATGTAAATAGAACTGGACATAGGACTAATTCAGCCA Chr1
[3] 1871 TTACGGCCTAGGATCAGGGGCGTCTATTCGGTATCATTCAAATTAAGAGACGGATCTTGAGGACTACGGGGATGTCTAAAGGACTTGGGCTC...ACCTAACTGGCGTGTTAGATGATGAGGTCCGAAAGATTGCGATACCGATCAGATGCAACGAGCGAGTATATTTGTCCCCAGGCGTTTTATGG Chr1
[4] 283 TTTAAGTTAATCATAACGGCGCTTAGGACCATGAGCACTAGAGTATGCTACGTCAATTGCTTTGGGCGTGTTGAAGTAGTGGATCAAATGAG...ACTACGGGGATGTCTAAAGGACTTGGGCTCGCTACTTTTAATGGTGTAAACAGGGGGGCAGGCAAGATCGTACCAATAAGGTAGAGTGTCTA Chr1
[5] 129 TTTAAGTTAATCATAACGGCGCTTAGGACCATGAGCACTAGAGTATGCTACGTCAATTGCTTTGGGCGTGTTGAAGTAGTGGATCAAATGAGTTGAGAAGCAGTTTTTAGTCACATGGAAGGCAAAGCA Chr1
... ... ...
[438] 324 GTACTCCAACATCCAAAGCGCTCTATTCCGCTTACTGACATCAATCAAGCCAAAGTGATTGGCGCAAACGTCGCGAACCTTATAAGACAGTC...AACCGGTTCTGTAATCTTCTGACACGTTTTGCCACACTGGTGTCGCACACAAAGCCTATAATACTAGGGTCGGAGGGGATCGCTAACATAAG ChrM
[439] 324 GTACTCCAACATCCAAAGCGCTCTATTCCGCTTACTGACATCAATCAAGCCAAAGTGATTGGCGCAAACGTCGCGAACCTTATAAGACAGTC...AACCGGTTCTGTAATCTTCTGACACGTTTTGCCACACTGGTGTCGCACACAAAGCCTATAATACTAGGGTCGGAGGGGATCGCTAACATAAG ChrM
[440] 324 GTACTCCAACATCCAAAGCGCTCTATTCCGCTTACTGACATCAATCAAGCCAAAGTGATTGGCGCAAACGTCGCGAACCTTATAAGACAGTC...AACCGGTTCTGTAATCTTCTGACACGTTTTGCCACACTGGTGTCGCACACAAAGCCTATAATACTAGGGTCGGAGGGGATCGCTAACATAAG ChrM
[441] 324 GTACTCCAACATCCAAAGCGCTCTATTCCGCTTACTGACATCAATCAAGCCAAAGTGATTGGCGCAAACGTCGCGAACCTTATAAGACAGTC...AACCGGTTCTGTAATCTTCTGACACGTTTTGCCACACTGGTGTCGCACACAAAGCCTATAATACTAGGGTCGGAGGGGATCGCTAACATAAG ChrM
[442] 324 GTACTCCAACATCCAAAGCGCTCTATTCCGCTTACTGACATCAATCAAGCCAAAGTGATTGGCGCAAACGTCGCGAACCTTATAAGACAGTC...AACCGGTTCTGTAATCTTCTGACACGTTTTGCCACACTGGTGTCGCACACAAAGCCTATAATACTAGGGTCGGAGGGGATCGCTAACATAAG ChrMextractTranscriptSeqs — splice-aware transcript parsing
For multi-exon transcripts, exon sequences must be extracted and concatenated. extractTranscriptSeqs handles this automatically:
library(GenomicFeatures); library(Biostrings); library(Rsamtools)
txdb <- loadDb("./data/TAIR10.sqlite")
indexFa("data/test") # index the genome FASTA first[1] "data/test.fai"DNAStringSet object of length 28:
width seq names
[1] 1688 TTTAAGTTAATCATAACGGCGCTTAGGACCATGAGCACTAGAGTATGCTACGTCAATTGCTTTGGGCGTGTTGAAGTAGTGGATCAAATGAGT...GCGAGACGTTCCCATCTGTTCGCTGGTACAAGCTGTAATCTAAGTTAAAGCAGACCATGTAAATAGAACTGGACATAGGACTAATTCAGCCA AT1G01010.1
[2] 1623 GTGGACCTATTCACTCCCTTCTACGTGCAATTTCCTCAGTGAATCCGAGGGGGGCCTACCACTCTATTACGCCCGAACGGGGTCCGCTCATTC...TAGGTCGCCGCCTCAAGGGGGAGCGGCTCTGGATCCGGTGTTGCGCTTTCGTAAATCTTTGTGTAGCCCCAGTCCCGCTGACTAGGCTCAAA AT1G01020.1
[3] 1085 GTGGACCTATTCACTCCCTTCTACGTGCAATTTCCTCAGTGAATCCGAGGGGGGCCTACCACTCTATTACGCCCGAACGGGGTCCGCTCATTC...CGTATACACTGCGCGGGGGGCGATACACGCATTCACGCCGTCACGCCTATGCTGGGCTATGATCTGCATATTGCTCATCAACCGAGTCGGAA AT1G01020.2
[4] 1905 GTATCCGGGTGATTACTGCTGTGTCCGCGTATGTTGTTGAATTACCGAATTGTGTGCACGATCGAGTGTCGTGCTAAGGAGAACCACGACGGG...GGGCCGGCGGGCGACTACCGATAGGGTACTGCCAAAGCAACCATGTGTCTCATCCAACTACACGGAGTAATCGGAACATCAAGTCACCGGAT AT1G01030.1
[5] 1239 GAGATGACTGTTCAAACCTCGGTATGCACAAATTGACGCAAAGCCATACTGCCGCGCAGCTCTTCGGATGATCGTGTGAGCGAACAGTGACCC...TGTGTTTACGAAAGACTGGCACTGTAATACACAATCAGCCGAACTGGTGTTCTCACCCCAGCATGACTCTTAGGGGAGCGTTGACGTCGACG AT2G01008.1
... ... ...
[24] 1062 TTCGCTCGAATGTACAAACACGCACCGCCCATACTACGAAGCAGCAGAATGTTTACGCAGTAGCACGTGCCCTGTCTTCTGTGCCTCCAATTG...AAAGCAAAAATCTGGAGGGGTTTGGAAGTAGAATTGCAACTGCCCCTACAAAACCTCCTGCAAAACGCATAAAAATTAATTTGCGATAAACG ATCG00020.1
[25] 72 TCATGCCATGAAGCCTATATACAGGGGCATCATCGTGCCGTGTTCCTGAGGGGCCGTCTCTTAATTACCGTA ATCG00030.1
[26] 324 GTACTCCAACATCCAAAGCGCTCTATTCCGCTTACTGACATCAATCAAGCCAAAGTGATTGGCGCAAACGTCGCGAACCTTATAAGACAGTCT...AACCGGTTCTGTAATCTTCTGACACGTTTTGCCACACTGGTGTCGCACACAAAGCCTATAATACTAGGGTCGGAGGGGATCGCTAACATAAG ATMG00030.1
[27] 462 TCTAATGTGAACAGTGCTAAGTAGTAATGGCGGTAAGCATAAGAGTCCAATAAGTCAGAGTTATTACATCCCGGCGAAGGGATTCCGTTCGCC...TCTGAAAAGAAGTGTGGCACCACCCGGATAGCTGACCGCTAATGAGGATAACTACCAACGGACATTATTGACACGGTATAATGAGGGGAACC ATMG00010.1
[28] 2568 TTACGCTCTAGTGTGTGCTCTTTGCTTAATCAATATCTGGCGTGGAAGGGATTTTACTTGCCTGCTAAATAATAACCTCCTTAAGTTTTGGTT...CGTCTCTGCAGACCGCTGTCAAGTGGCAGTTACCCGTCCCTTATCACAAGAGTCCCACTGCCGCCCATAAGTGACCTGAGGTCCCCGAGGCA ATMG00020.1Tip
Use getSeq for simple range extraction (genes, peaks, features).
Use extractTranscriptSeqs when you need spliced transcript sequences that span multiple exons.
HW05
Important
Assignment: HW05 — NGS Analysis Basics
The homework is based on the sequence analysis, FASTQ processing, and range operations covered in this tutorial.
Summary — Key Functions by Topic
Biostrings — sequences
| Function | Purpose |
|---|---|
readDNAStringSet() |
import FASTA file |
writeXStringSet() |
export to FASTA |
reverseComplement() |
reverse complement |
translate() |
DNA → protein |
matchPattern() / vmatchPattern() |
pattern matching (with mismatches) |
countPattern() / vcountPattern() |
count matches |
PWM() / matchPWM() |
position weight matrix search |
ShortRead — FASTQ
| Function | Purpose |
|---|---|
readFastq() |
import FASTQ file |
sread(), quality(), id() |
access sequence, quality, ID |
seeFastqPlot() |
QC report (systemPipeR) |
trimLRPatterns() |
adapter trimming |
trimTails() |
quality tail trimming |
nFilter(), polynFilter() |
N and complexity filters |
FastqStreamer() / yield() |
memory-efficient streaming |
GenomicRanges — ranges
| Function | Purpose |
|---|---|
import.gff() |
GFF/GTF → GRanges |
findOverlaps() |
find overlapping ranges |
subsetByOverlaps() |
keep overlapping ranges |
reduce() / coverage() |
merge / per-base coverage |
getSeq() |
extract sequences for ranges |
extractTranscriptSeqs() |
spliced transcript sequences |
Next: T7 — Workflow Framework
